Description :
From Genome Similarity Track
Location :
Scaffold_83:879- 2756
Transcript NameFunction/comments
g2514.t1hypothetical protein

Sequence
1877 bases(100 bases per row)
CCACACAATATCCTGAAGCATCGGTTGTCACGATGAACGGAAGAGGGAAATTCGGTAAAGTCAGGACTGGGGCGGATTGCAATGCTGATTTTAGCTTGCT
GAAGGCGGTATCATGCTCTTCATTCCAATTCCAGGTATGGTCCTTCTTGACTAGAGGTCCAAACGGTAAGGCGATTGTCGCGTAGTTGTAAATGAAGCGA
CGGTAGTAGCCTGCTAGACCCAAAAAGCTTTGCAATTGCTTTTGGTTCATGGGAATTGGCCAATTGGTGATCACTTCAGTTTTCTTGGAATCCACCGCGA
TACCTTGACTTGACACGGTGTGACCCAGGAACTGCACTTGATTCTGCCCAAAATGACACTTCGAACGATGACAGTACAGCTTCTCTCTGCGTAACACTTC
GAAGAGCGTGCGGAGATGCTGCAGATGCTCCTTCATGTTCTTGGAAAATACACAAATGTCATCCAGATACACCACGATAAACGGATATTTGCCTAGTAGG
ACACGCATAAGACGTGACCAGACACCTGGCATTCCAGCAAGACCCATTGGCGCAACACACCACTGATAGGTCTCAGAATGAGTGCGGAACGCTGTGTACT
GACGACTTTTCAAGGCAATCCTCATCTGATGGTAACCTTGCGCGAGATCCAAGACTGAGAAGATGATGCATCCATACATCTTGTCAAATGTTTCGTCAAC
TCTTGGGAGTGGAATTCTGGCGATGATCGTTTGCGAGTTGAGCCAACGATAATCAATCACCCAACGAATCGGTAACGTAGCATTTCCCGACCGTAGCCAC
TCAGCTCGAGAAAGTTGTTTCCCTGATTTCGGGTCTTTCTTCGGGATACCAAAGATGTTGGAGACCCAAGGTGAATCGGATAGTTCGATCCAACCTTTCT
TCAACTTTTCTTCGACAAACAGATCAAGGGCATCTTGTTCTGTCTTCGAGAGCCGAAAAGGTGCGCGTGTGCTTGGCATAGCATCTGACTTCATGTTGAG
CTCGAATTCCACGCGTCGATGAGGAGGTAACCCATCGGGTAAAACGTCTGGAAACACGTCAGCAAACTCATCAAGGAGAGGCACAATTTCTTGTGGTTCC
TCCGTGACGGGTTGAGCTGGAGTAATTTTGACGCGGTAAATCTCATCGTAGTCATGGCGCTTGGCTTTGGCTTTGAACTCAGCACCAGATACTTCCACCT
TGCGCAACACTGGCTTTATTCCTTGCGGTTTGAACTGCAGGTGATGAGTACGCCAATCAATAATTGGTTGGTACTTGGTAAACCAAGGTTTTCCGAGAAT
GACATCGTGTTCAGGACTCATAGACCATTCCAGGACCTCTAAGTCTCTGAATCGATAGCCATCCATCTCAATAGTGACCTTGCCCTTGTGAACGGCACGT
TTTTTCGTTGTGCTTCCGTCAAATAAGGTGACTTGAGAGATCATGGTGTCAGGAATAGTATCCACCAATCCAGGACGAATGACATTGCATGTGGCTCCCG
TGTCTAACATAATGGTAACACGTTTGCCTTCACACAGACCTGGCTTCCGAATCAACTCATTCGGAGCTGGTAGTGACTGGATGGTAGCAGCGTTGAGATC
ATTTATCTCAACAACTTCAACGGACTCTGGCTTTTCAGTGGCCAAAGTGTGAACAGCGAACTGACCACGCTTAGTGTTAGACGGAAAGCTGTTGTTCGCT
CCATGATTCTGTCGATTTTGAAGCTTGAAGCACTGTTCAATCGTGTGACCAGGCTTCTTACAGTACCGACACTTCTTCGGGTTGCCACTGTTGCGGTTAT
TGTTCTGAACAGGGCGACGATAATTGTCACGGCGGGGGTTATGCACATGACCAGTGTCGATTTCCATAGGCTCAGGT