Description :
From Genome Similarity Track
Location :
Scaffold_764:879- 2114
Transcript NameFunction/comments
Phyin_T30-4PITG_21872Myosin-like protein

Sequence
1235 bases(100 bases per row)
TCGGAGCAGGAAGACAGCTCTACCAGTGATGACTGGATGGAGCCCCCACTCCGCATTACCGCTCCGACTCACCGTCGCACCAACAGCAGACGCGCAAACA
GTCGACGTAGCCGTACAAGCAGCAGCCACGTCGACGATCGCAATTCGCTTCTGGAGAACGAGATCTTGCGCTTACAACAGATGCTGGTAGAGCAACAGAA
CGGTAGATCTCGGCAGGATCAGCAGCGCCGATCGTCGGCTTTTTCTCGCCCGCCTCGGAGTGCCCCGCTGGACTTGAGTCAATCCGCCCGTGTAACGCGC
TCACGCTCCGGTCGTCGTCGGTATTCAGAGGACGGTGCCTTATCCGAAGACGAGGACGGAGAGAATGACGACGAAGCATCGCTGTTGCCACCACGTCGTG
CGCGGAGTGTCATGCCGGCACAGCAAGCTGATCACGTGTCCATGCTATCGCAGAAGATCGAAGAGCTGGACGCCAAGTGCAAGTTCCTGGAGCAACTCGT
GGCTCGCAAGAATTACGAAGACGCCGCAAGAGAATCCTTCATGTACGGCCGAGGGTCGTTCGGTGGCAGGGAGCGCTTTCCCTCTGCGGACGGATCATTG
TACGGCGACACCCCACCGAGCGAAACTGGATCGGATGTGGACTCAATCATCTTGAATATCCAGAGCCAGATGAACATGTTGCGCCAGTCTATCGCTGGGA
AGGAGCAGGCCCTCCAGACGTCTCGCAAGTCGCACGCCTTGTCATTCTCATCCAGCACACGGCCGACACGCTCCTCGTCAGCTGCATCGACCACGTCGTT
TACGAATCTGCCCTTGGGTGAGGCCCCACCGAGTCTCCCGTCGCTTCCGTTGTCCGAGTCGCAGCTTTCAGCCGGTGGCTCATCACATGGCAACAGTCGG
CGCAGTGGCGGTAGTTCGCTTGGACTTCCTCCAACGCCAACGTCTTCAGTAGCGTCGTCGTTCTACCAGGGCCCACCCCGTTCTTCTCCTGCGAATTTTG
GTGGCCGTGGAATGCCTCGAATCGTCAAGTGGGCTCGCTCCACCAACTGCTACGAGTGCGAGGAGCCGTTCAACTTGTTCGTGCGACGACACCATTGCCG
TATGTGCGGTAACTCGTTCTGTCACGAGCACTCGAGTCGACGTGTGTCAGTCTTTGGCATCGGCTTCGACGACGAGCCTGTCCGCGTCTGTGACAACTGC
TTTGCCGAGTACTATGCAGCGTCGCAGGAGCCGCA