Description :
From Genome Similarity Track
Location :
Scaffold_16:87891- 104983
Transcript NameFunction/comments
Sapdi_VS20SDRG_05881hypothetical protein
Sapdi_VS20SDRG_05882hypothetical protein
Sapdi_VS20SDRG_05883hypothetical protein
Sapdi_VS20SDRG_05884hypothetical protein
Sapdi_VS20SDRG_05885hypothetical protein
Sapdi_VS20SDRG_05886hypothetical protein
Sapdi_VS20SDRG_05887hypothetical protein

Sequence
17092 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCTTGCTGCATAGCATTTATTCACGTCAACTTCGCCCTGTC
TACTTGTATAATGTCGACTCGGAGGCCGGCCGCAATCACGAGGAAGCATCACGAGAGCGTCTGCTGCACGTATGGTCCAGTGGACAGTATACTCGCTAGT
CGATCACACATACTAAAGATCGCGATTGATGTTATCGCAAAAACCACGTGCATTGTACCACTATATGCTTGGAGTGCCATCCGGAACGGGGAGCTGTTGG
GTCACTCGACAACGGACCAGGTGCATCTTTTCATGAGCATGTACGAGACCACTGCAGCGTTCGGCATCTGATTTCTGGGGCGGTTGATCTGGAGCGTTTG
AGTTGCATCTGATTTGAAACATGTGGCACGGCCACAATTGCACAACATCGCAAGCGCCAGGAATCCATGTCCAGTCGACAACATCGATTTACTCGAAGAC
GTCGTCGAGGACCCGGCTACAGCGCACGATAACACAGGAGGATGCGCCGAGTATTTTCGTTTTTTCAAAGCGTGCAGCTCGCCGTCGACACTCGGCACGC
TCGATGCAGCCTTGAGAGGGTACTGTAGTTGTCGCTTTTGTGTGGCAGTAATGCGTCGACAGAAGGTGTAAACGTCGAGCAACGACAAAGCATCTCAACC
ACTATCAATATTAGATTCTACAATACATGTATTTAAAGAAATATTTGACAACCTACAAGATATTTTGAGTACCACAATATATAGAGGATAGAGTATTTGA
GAGGTATCCCGACCAGAATTGCCACAGTGGCTTCAACTCAGATGTGGGCAAACTCAGTATCAGATCCCCAATGTACTTTCTACCATAGCGTACCGGAACG
ACTGCTCCCGCGATTACAGGCGAGGCCACCGCTCGTGGGCTTGCTCTGCGAAATCTCACCCACTCTGTAGGAGCGGTTGCATGACCATATATAGCCAAGC
GCATGCTTCGACAAGGCAGCGAGAGAGGCTTGCTCTTGCATCGATGACGTCGCTCAGCGCGTGCTGTCGACTAAGGAAGCCAAAGTTATCTTCGTGTCGC
TCCAGTTTGAGTTCGACACGTCATGCTTTGGGGCTTGAGAGAAGGAAGGACATATGTGTATACTGGTGCGCTTGTGGTCAAGAATACTAGTAGTCCTTTA
ACGATGACCCAGCACGGAGCAAAGGACTGACACCGTACGTCCGTAGCTCGAGTTGCTCTGGCGAGCGCTTACGACGACAATTGCGCTCAAACAAAGGGTG
TATGCGAGAAGGACATCATTCAGAGCCAAGGAAGGAGACTCTGGGCAATCTCGGTGCAGATGTCGAGTTCGACTAGTTGTTTCAAGCGTGTGCCAGTAGG
TACGCTAGTAGACGCGAGAGAAGCGACTGGTTTGAGATCTACTAGGTTCGCCGTGGCGTTGCTCCAGTACATATTGAATACGTGATGGCGGGGTCGCTTG
AAAAAGATATTTCTATATACTAAGTGAACACGCGCTCATGACCCGGTGTGGTGCTGGGCCAACATCAAGTGCTTCCGCAGCTCCGCTTCGAACTCTTGAG
GCGGCCGGGGCACAGCCACGACGCTCAAGCGTCCATTGCCCCAGACGTATCGGAACGACGAGTACGGCGGTGGCACGGCAGGAGAAGGTTCGCACAAGCA
ACGCACGACGCTGGCGGCACGTCTGGCGGCGCGTCTGGCGACTTGAGCAGGACGAGGTTTCGACCGGTCCACAGCACTGTCGTTTGCACGCATTTCATTG
GCGACCGTATTCGCCGCCGGCAACAGCTCGTCGACCACCGGCCCCGTCTGCGATGCCTCAGCAGCATCAGCAATAGCATCGTTCGGGGTCGAGCGTGGCG
CGTCCGCGACGGCGACTTCCGCGACCGGCGCCGGTTCGCTGGTCGCAGGTGCGGTCGGTTCGGGTGCTACTGCATCCGACACGCTGTCGGAGGGACGAGG
TGCTTGGTTGTGGGCGGTACGCTCGTCGACTTGGTCCAGCTCGTTCTCTTTGACACTTGGCAGTGGTGCACTCGCTTGGCTCTCCTTCTCGGTGCTTTGT
GTCGGCTCTGTCATGGGTTGCGTGTGCCAGAGGTCGTTGTCCATGGCGGCACCGACGCCTTCGACATCCGAGTCGGGCGACGAGACAGTCGCTTGGCTAT
CGGCGTCGTCGGCGGTCTCTTGGCTGTTGAAATACTGCGTCTGCGGACCGGCAAAGTCCATCACAAGCAAGTCTCGTCCTGCCTCGCGGCTTGGCGGCGC
TTCTTGCGCTTGCGCTTGGCGACGCGGCGACGCCGGTGGCATTTGCGTCTCGTCGTCGTCGTCGTCGTCGACAAGCGAAATGGACTGCTGCGCGTCGGCT
TTGGGCCAACGCACCGACTCGGCGGCTTGCGTTTGTGGCGCGACACTGTCCTCGTCGTCGTCATCCTCAATGTCATCTTGGGTCAAGTCGATGCACGCGA
TGGCGTCGTCTTCTTGACTCCCGAGAGTGCGCACATGCGCCGTGTTCGCTTTGATCGGCGATGGTTTCGACGGGAGGCGAGAGAGCACGTCGGAGAGCGA
CGGCGACGCCGGAGCGGAAACCTCGCGCATGCGCGGCGGCAAGCGCGAAAGGACCTCGGGGATGGTCGACGCTGTACTCCGTGTCGGTGGGCTTGGTGGC
ATCGTGAGCCGCGTCTTGGCGTCATTGGCCGACGACGCAGACGCGGTCATGTTGAGAATCGAGCTGATCGAGTGGCTCGCAGGACGCGACGGTGGGAACA
CAAACCCAGGCGCGCTGGACGTTTGGCGCGGCACAGGTGACGCCGCCATGCCGTGGGTGATATGGCGGACGGTGTGCGGCGACGACGGCGTCGCCTGTGA
CGAAGCTCGCTTTGGCGACGGCGACTCTGCTGCTGGTGACGCGGCTCGCTTCCGGCGCTGCGGCAACAGCGGCGACTCTGCTGCTGGTGACGCGGCTCGC
TTCCGGCGCTGCGGCAACAGCGGCGAGGAGGTCTCGGGAAGACGGACGGTATCTGGGGCGTTGTCGGCGCGCCGCACAGGGCTGGATTCGAGAGGCGAGA
CAGAGGGCGCGGGTCGGGAGCTTGCGGCGTTGTTGGCGGCGGGGGCTACGGTGCGTGTGGCGACGGATTGCGTCGTGACCGGTCCTTGTGCGACGTGCGT
AGTTGTCGGTACTGCTGGTGAGGCAGGCGTCGAAACGCGTGGCGCAGCGGGTGGTGGTGCTTTTTGGTCGGCTGCTTGTCGCGGGCTCTCGTTGGCTCTC
ATCGTCGTTGCCTGGCTTGTCGGGACTTGGGACGACACGAGGAGGTCTTGGCTCTCGTCGTCGTCGTCATCGTCGTCGCTTTCGACGGGAATAAAGTTGG
TCTCAATGTCCTGGTTGGCACACGCCAATGGCGCCGCTTCGTGGAGCTTCCGCGCCTGGTCGGGCGGAATGATGCAATCGGTCACACAGAGTTGCTCGAT
CTGGTACGCGTGCGGAACCGTGCTCTCGGCGAGCAGGCGTGCTTCGAGCTGCGCCACCATCATCGAGCTGAGGACCGTGAGAAGCGACGGATGCCGCGTG
ACGAGCAGCGTCTCGGGCACGTGCACGTTGGTCGCGTCGACAATCACGAGTGCATCGACGAGCATGCACACGCGCGACGCCGTGATCGCGCCGTTGGCCT
TCTTCATGTGGCGCCACGGCGTACCGTAGCGGAACTTGGGCACGCGGATCGTAAACCCGCGGAGGCCTTGGACCGTCTCGATGTGCGGGAACTCGTCCTG
GAGGCTGGCGAGGACGCCGCGCTGCAAAATACACCAGATCGAGTGGCGCCCGTCGCTGACCAGGATCGCGTCATTGGCCGAGCTCGTCTGCGCCACGAGC
ATGAGGCTGGGGCCGAAGCTGTTGGGCGGCTGCCCGCCCGTCGCTGGCAGCAGGAGCGACTGCAGCGTCGACAGCAGGATTGGCGTCACTCCCCGCATCC
CAATCGCGATTCGATTATTCAAATTGCCGCGGCCATCCGCAGTCATCCGGATACCGCTCTCCCAAGTTTAACTCGTTGTTGAGAAACGCCACGAAGCGCC
AACCGAGCGCTACGAAGCGCCAACCGAGCGCTACGAAGCGCGATACGAGCGAGGTGGCATGTGTCGCCACATTCACAAGCCCTTCCTTCGATGCCGACGA
TTCACTATCTCTTGCTCCGCTCATGCGTCGACGGCTCACGAGATCGGTCGAGTGTGTCATCTTGAGCATGCTGCATCAAGCAGCTGACTAGCCGGACAAG
GCCGTCCGGCACAATGCGCCATAGATCCACCGTGGACGTGGCTTGGATGATGCTAGCGTTTTGCTGTAGCTAGTGTTGATTCACAGATATACATGACACA
TTTCTCCACCCTGTCGAGCACGTGGCCTGTCCCAACCTGCAACTGCTACCAGTTACAACAAACCATGCGTAAATGGCTCCGCCATACTGGCACCAACGAC
GACGACGATCGATCGCCACGGACTACGTCTGATGCCGCCACACCCGCGAGCAGCCACGTGCTTCGGCTGCGTCTCTTCTCCAAGGTGCAGGTGCTTTCAA
CGCGCAGCTTCAAATTTCCGTCGTCCATGCCCGTGCCGACGAGTACGAGCAGCTCCGTAGTCGTCGCACGCACCAAGCCTCGTCAACCACAGCGCAAGAA
GCTCTTTCTCTTTCCATTTTCACTCCAAAAACCCACGCAAATGCTCTCCAAGCTGCTCCAAACGCTCCCAAATGACCCGTTTGGCGTCGCCGACAAGATG
AGAGCGATCGCCAAGCGACTGTGGTTCACGCGTGCACCACCGCCCACCGCGTACCATTTCATGTTGCATCCGTTTGCATCTAATCACAAGGTGGTATTAG
AGCCAGCGACACTGGCACCGCCATTGACGTCGAGGCGCAGCTGCGAGCGTGGGCGGCCCTCGCGCGTGCCAACGTCGCCAAATTGATCCGACGCAAGCAG
CTCCGCGATTACGCGGTACACGAAGCGCTCGCGATTCTCGACGCGACCGTCCACACTGTGCTTTGGAAAGCAAAGATGGCTGCAGACCGCCGGCACCTCA
TCGCGGCGCTTTGTATCCAGCACGCGTGGCGATCGTATGCGGGGCGACGACGCAAGCGCAGCTACGACAAGAGGCACGTTCTCGCCACGCTTCGGAGCGT
TGTCGAGCGCATGCTCTGCGCTCGGCTCGTGCCGCGACTCGTGGCCGAGATTCTCGCCCACGGCTGCAGTCGCATGGCCATCCGGACGATACAGCGGGTC
TGGCGCGGGCACAAGGGCCGACAACGTGCTCGGCTCCGACGCCGGCGCGTGCAAAAGGAGCAGCGCGCAGCCGCACGCGAGATCGCGCGGCTGGCCAAGC
GCCGGGCGCTCTTGGCGCGTAAGACGTCGCCAATGCCAGAAACGGAGGGAAACCCTATGCGTAGCGCCAGAGAATGGCAAGCGACTCGAGAGCATCAAGC
GCACGTGGGCGCGCGACGACTTTGTACCGTCGCCACACATCAAGCCGAGCCGCCTCTTGCCGCGACACAAGACGCTCCACCCGCTGCCGACGCAGACGCC
CCCGGAGAGCCCCCTCATCGCCAAACTCTCGGTGCCAAAGTGGACGCGGTGCGACGACACGGCGATTCCTGCACGTTCATGGACGCAGAACAACATTGTA
GGCTGCAAAAGCCCGTGCGACCGAATGCGTGCTGGGTAGCCGTGCCGATCCACGTCACCGACCATGCACACGTCGACAACCTGCGCCCGCAAAGCCGCCT
CCTCAAGCGGCACTACGATTTGCAGTACGATTGGGTCCCCGCAGGTCTTCTCCAGTCGACCACCGACGTGCCAGCTCCCATAACCTTCGAAGACAAAGTG
CGGCGTCTGATGCCACCATGGGCCACCAGCGTACCCAAAGACGTCCGCCTCCAACCTCTTTTGTCCAAGCCCAAGCTACACACCGTGCGCCACCCGTCCA
CGAGTCCACGAGACAATTCGTCAGTCATAGACTTGGCCCAACCCAACCGTGTGGCGAAGCCAAGGTCTTGAAGCGCCCTCCGTCGTCCAGTGTACGCAAA
CAGTGTTTTTGCCGGCGCACGCGACCATCCAAGATTCTCCCCGCCATTTACGGATTCTAAAAATACATTGCCCTTCGCGTACGTCATATCGTACGTACAT
CAAGTCCATTCGAATACATACATCTAGTATACTCGTACACGGCGAGGGTTGTACGAGACGCAAAACCTCTACAAACGAATATTTACCCAAGGCTCTTGGC
CACTGATCGTGTGGGTGGACATTCGTGAATTCACAAGATGCTTGCGCTGCCCCCTCCCCCCTCGACGCCGGCCAAGGACGCGGCCGTGCTCGGCCTCGGC
GGCTACCCGCACCTCAAGCGCGTCGAGATCGCCGGCCGCTCGCTGCACAAGCGCGTGCGCAACGCGGCCCGCGGCCGCTCGCTCTCGATGGAGTCGAACG
GCGAGCATGATGCGCGCGCCGAGGCCAAGCTCAAGGAAGAGGCCATCCTTGCCAAGTACCGCAAGTCGATCAAGGGCAAGAACTTCATCAACTTGACCAT
GTACCAGCAGCTCGGCTTGACCGACGTCATGTTCGACGCGACGCCCGACCAGATCAAGAAGGCGTACCACCGCGTGCTCATTGAGCACCACCCGGACAAG
ACGCTCAAGGACGAAAACGACCCGAACTACCTCGCGGTGCAAAAGGCGTTTTCGACGCTCATGGACGCGCAGAAGAAGCGTGCGTACGACTCGCAGTGCG
AATTTGACGAGTCGATCCCGAGCGGCAGCGAAAAGATCAAGCAGAACATCACGGGCGCGGTCGACCCGAAGGCCAAGATCGTGGACTTCTACGCGCTGTA
CGGCCCCGTCTTTGAGCGCAACGCGCGCTTCTCGAGCATTGTGCCCGTGCCCATGCTCGGCGACGACGAGACGGATATCGACACGGTCCAGTCGTTTTAC
AACTTTTGGCACACGTTTGACTCGTGGCGCGACTTTACCCACAACGCCGAGCACGATGTGGACAGCGTCGAGAGCCGCGACGAGAAGCGTCACATGATGA
AGAAGAACGAAGCGCAGGCCAAGAAGCTCAAGAAGAAGGAGTACAGCCGTCTTGCCGACCTCGTCGACCGCGCGCAGGCCAACGACCCGCGCCTTCGCCG
CGTCAAGCAGGCTGCCAAGGACAAGAAGGAGAACGACCGCAAGGCCAAGGAAGCTGCCGCCCAGGCCATCATCGATGCCCAGAAGGCCGTCGAGGAGGCT
GCCGCCCGCGCCATCGCCGAAAAGTTGGAAGCGGAGAAGAATGCCAAGTCCAACGCCAAGATGGCCAAGGACAAGCTCAAGAAGGCGTTCCGCAAGGTCA
AGAAGGCCTTCCGTGAGCTCGTCGAAGCCATTGACGACCCGCGCGTCGACGCGGAGGAGACTGAGTTTATCTGCGAGTCGATCGAGATGGACGCCATGGA
GGCCTTGAACGCGGCGCTCGCGTCGCCTGCTGGCATTGAGGACGTTGTCAAGGTCCTCACGGGCCTCCGCGGCGACGCCTACATGGCTGCCAAGCGCGCC
TAAATATTGCTAGGCTCTTGGGAATACACGCTCCCTTATTGCCTTATCTCATGACAGATGCTTGCCCCATGACATCCGCTTGTCTTATTGCCGCGGAGCA
ATCGTGATGCGGTCTTGACCCGGCTGGATGCCCATGTCCTGCAGGAATTTCTGCATGCGCGCGGCCTCGGCCTCCTGCGCCGCCGTCACACGCTGCTGCT
TCTCATCTTGGCGCTTGTCCTGCGCCGCCTTTCGCCGCTGAATGCTACCGGAATCATGTCAGTGAGGTCGAGCGCTGTCCTCGGCAGCGTACCGAGCTTG
ATAGTCGTCCGAGCCGCCCATCAAAAAGTCGTCGCTCAAGTCGAGGCCGTCCTTGGCGTCCTCCTTTGCACGCGCCGCGCCATGCAGCGTCGCCGCCTTC
TCCCGCTTCTTCTCGATGTTCGCATCCCTACCGACGTTGGAGCAAAAGAGGATGCAGTGTTGTTGTAGCCTACCGGCCCGTGGCCTTTGGCGCGAGCTCT
TCCATGACCGACTCTTTGTGTTTATGGTACCGCTTGCGCTCGTACTTGTCGCGCTTGCGCCGGTCGTCCGGGTCGTCCGAGTCGGACTCGTGCTTCTTGC
TGCTGCGAGGTGGGGCTAAGCAATAGCAATAAAGAACGTACTTGGCTGATGTCCACATATAAGACGACGTACATGTCGTCTTGGAGGGCCGGGCAGTGGA
CGACGCGCCCTTGTTGGTCGTAATGTCGACCGTGTCCTTCGTACTCGCCAAGTGCAAGCGCTCCGACTCGTTGAGGTTCTTGACAAAGCCCCACTTATGC
TTGGTACGATGGATGCTCTCAAGGACGTGCTGCGGGATGCTCGAGTAGTACATCGCGTCGAGCTTGCCGTCGTTCCATCGGCGGACAAACTTTTCAAAGT
ACTGCAGTGCGTCGTCGGACGTGAGGTCCTCGAAGTAGAGTTTCCTACGCGAGCATGAGCCCACGCAGGAGGTAGACATGCGTGAGTACTTGTCAGTCTT
GAGCCACACACGGAACTCGCGCGCCTTCTCAAAGTAGTCGTCTCGAGAGATGCGCTCGTGGTCGCCTACATCGCATCGCCATCGTCGCATGAGGTTGCTG
ACCCTTCACGCGTAAGCTACCTCGCTTCTCGGACTTGTGCTTCTTGTGCTTCTTGTGGCTCTTCTCGCGCTCTATGCATGTACGGTCCATGAGGCTGCGC
GTTCCCGACCACGCGTACCCTTGCGCGCCGGGCTCTCATCTCGCTCCTTGCGCTTGCTCATGTTGGCTCACCACGTTTCAAAATGATTCGGCATGTGCCG
TTGAGCCACGCTAAAATATGGCATGTGCCAACATTGATGCAGTTGTTTGCGGCATTTACGCGATGGAGGTGGCATGATCACAGCACAAAATAAGGCGTAT
GCCATATCCTGTGAAACATGATGTGTGAACCGTTGCATTATCCTGTAGCATTTTATATTGGTAATAGGACCGCCGACGGCGACGACGCTTGGGGCAGCGC
GGAAGCACATGCGTCGTTAGTCGCATAGCGAATGACATCGTCGTTCTCGTCTTCGTCTTCGTCGTCCGAGCTCTCGTCGTTACGCTCGTAGATCTTGTAC
CGAAGCAAGAAGCGCTTGAGCCACGACCAGGACGCCGTGAACTGCTTTGCACTGAGGCCCAGCGCCGCCGCTTCTTCGCGCGCCTTGCGCTGCACCATCG
CATGTGTCACGTCAATGCGGTCGTTGCGCAGCGCCACGATCCACTCCAAGATGCGGTCTTCGACCTCCAGCGGCAGCGTGGTGCTGAGGCCCCGCGGCCG
CGTGTTGCGGAGCTCACTCGTCGCGGGGTCGCTCGCCTTCTTGCGGATGTCGTCTTTGCGCGCCGCCCAGCGGTATATCCTTGACCGAGCATTGTCACGC
GCCCTGCCCACGAGGCCAGCGTAGTACATGGCCAGCGTTTTCTGGATGCCGTAGGCTTCCAGGTGCTCGAGCATCGCGAGCTTCTCGCGGTACGTGGTCA
TGACGCACGGAGAGCGTGTGGAGCTGGCCCTGTGTCGGACGTCGCTCGTGGAGAGGCGCGGCCGGCCCGGTCGCCCTTGCGCGACGGACGTCATGCAGAA
AAGTCGAGTGTGCATGCACTCTTGAACCGTGTGATTTGTCAAGAAATGCGTTTTCAGAGGTTTCTACGGAGCATGACATTTGACTCGTTGTGTCTGCAAC
ACAAAAGCAATGACAATGTTGTCGACACTCATATTGCGTAGTTATTAGCTACCAATCGAGATCGCCACACTAGTTGCCGTTGCAACGAGACGTCGTGGTC
ATTTTGGCAGTCGAAATGGATGCATATGTGTGCTTTCGAGCTTCTTAGCAACCATTGGAAGGTCATGTGCAAGGGAATAAATAAATTTGAACAATCACGT
CAACTATTGTCATGCAAAAAGTGTTCCCATACTGTAGTTGCCCCCGCCAGTGCCCCTGGTGCTCTCGGAGCGTGCAGGTGTTTGCCTCGAACGTGCATTT
CATTGGCTATTTTGTTGTGAATTTCGACCAATCGTGTGCGCGTGAGATTCCATCGCCTGGCACTCGCTCGTGGGAGGCCATGCGATCGACCAAATTGCGT
TTCGAAATGGAATCGCTCCAACTTGGCTGGGTGATAGAGCGCGCTTTGGAGAGCACGAAATGCTACGCCACGTCGACGTGTAAGCCATATAACAAGAGTT
AGGAGTCGGAGTCTTAATCGTGGCAGACGCCACTTTTATCACCTGACATACCACCAATAAAAAGTGTAAATCTGGTATATGCCATAATTAATATCGTGGT
CCATAACTAGTGCTGCACGGCTTGCACGTCAACATAATGTAGCATGTCGTGACCTCCAAAGCGCGCTCTATCACCCAGCCAAGTTTGAGCGATTCCATTT
CGAAACGCAATTTGGTCGATCGCATGCCCTCCCACGAGCGAGTACCAGGCGATGGAATCTCACGCGCACACGATTGATCGAAATTCACAACAAAAGAGCC
AATCAAAAGGCTTTATCCAAAACGTCCGGTTGATTCAATTTTCGTATCTGGGGCAGGCGCGATATGGTATCGTATACACTTTGTCATTGTCATTGAATAA
AAACTGACCGCGTCATCTATTGCTAGAATAGAAACAAATCCATCAGCATTGCTGTTCTGGACCTCTAGGATGGCTTGGAACCTCAAGCGTTAAATTACGC
GGCGTCGCGGCAACCATTCGCCAGCACGTCGACACCGCCAAAAAGGCAAGTGGCAAACCGCTCGTGAAGAGACGGGACGGCATGTGCCTCAGCACACGAT
TGCACTCACAAGCCGCTCGAGTTTTATCACCCGGACGTGAATGACCGACTAACTTCATTGGCGAGGCGCTATGCTTCTCTGATCCGATGTGCGTTCTCGA
CGCTCCGAATCGTAAAAAGCAATGGCAATGTTGTCTACACTGAAGTTATCTACGATCGCTACGCTAGTTGTCGTTGCAACGAGACGTCGTGACCATTTTG
GCAGTCGAAATGGATGCTTTAGAGCTTCTTGGCGACCTTCTTGGCGACGGCCGTCGAGCGAAACCGGTAAAAGACCATGCCAGTGCCCATGAGGGCCAAC
GAAAACCTACAAGAACTTACGGCGCCAGCATCGACCACGAGGATACCGTACCAGATGCCCGCGTACATGGCGTGCTTCCACGGCGTCATGTAGAACTCGA
GGTACTGGTCCTTGTGCTTCTTGACAAGCTCTTGCGCGCTCTTGGCTGTCGTCAGTACGTCGTTGAACTCTTCGAGGAGAATCGGCGTGTACTCGGTCTT
GCCCATCATGGCGTGCGCGAGCTCGGGCTGGTTGAGCCAGAAAAAGTGGCGCTTCTTCGGCTCGTTGGGCGGCGAAAAGGTCTTTTCCTATCAAGCCGAT
GCATCCGTTGCGGCATATGCCATTTTCAAGAGAATGCAGAGAAGGCGACGAACCTCTTCGCCTTGGACCATGACACCCACGAGCTGCACCTTCGCAGGAG
CAGCCTCGACCTGGGGCGGGCGCGACGTTGTCAACGCCATGTGCTTCTCCATTTCGTCTTTCGGCAGCCAACCGCGGTTGACAATCACAGACGTCCTATG
CTCAATCATGATGGTATGCGCTGCGAGCGACGGTATTATGTACCCGTTCGCACGCTCAAAGAGGTCGTAGATGAAGCCACCGGACGACACCTTACCCTTG
CTTTCCGACATGTCGATGGGCGGCGACCGCGGGTCTATTCGTAGCTATATAAGCACCTTGTTTGCATCAGGTTGTACTACAGAGATAGAACGTCTTGCCC
GGCACGAAATGGCCCTCGACAGCCAGCTGCCGGTGCTCCAGCTCGGCGCTATTCGCTGCATGAGCCACCTCTCTAGCATAGCCAAGACGATCGTACTTGA
CGTTTTCCGCAGAGATGTCCCGCGGGAGTGGTACGGGCGCTTCTTGCAGGCGCTGGCGGCGCGTCTCGATGAGGTCGACCTTCCAAAAGTACCGGTTGCT
CTACGCCATGGTTGCACGAGCCGTTGCTGCATCCCATGCGCCGTCGCGCTGCTGTACCTGCCACACGCCCATGCTGGCCGTGCCGGCGACGATGCTCGAG
AAGATCCCGATGCCAAGCAATTGACCGCGCTGCATGTCCTTCCTTCTTCGCCTTTGGAATTCGTTTGAAGCGTGTTTCTGCAAAACGGCAAACGCCACCT
TGAATACGCGTTATATGTGGCATATGCCATTTTCAACCAGACTGTATTCGGCATATCCCGCGCTGCAGTTGTCTTATTCGACGCCATCACGCATGCCTCT
CGGCCTGCAGCCTTTTCGCTGTTAGGTAGATGGGGTACATAGACCGCATACGCTTTGCAAATGCAGACAGACCAAGGAAAATACGAATTCTTATTTCTCT
AGAGACCGACGAACATCCGGCATGAGAGCGAGGTGCCGCAGGACATGCCGAATTTAGTGGAATCTATTTTTAGCACTGATTCGCCAAAAATCAGATATCA
GAGAGTGATGCAAGCGATATTGCCGTCGCTGCCCGAGTCGGCGCCGCACGATGGCTCGCTTCTCGCGAGGAAGAAGCCGCCGCAGAGTGCCCGCAGCATT
CTTCTGCGCTCCAAGGTGGAGCCGCGCACGTCGCGAAGCACGGCGCGCCGAGGCAACACCCGCCCCACGCCCGCGTCCAACATCTGGTCACACGTGGTGC
GGGTGGCCGTGCAGAAGAAGAAGCGCGAGCCAACGCCAAGTACAGAGAGTAATGCATCCTCTTGATATCGTGCTGCTCTCGCTGATGGCAATGCTGCCAG
GCGACAACGATGGTGACGCGCTCTCGTCGGCGAGTGTGGCCACGAAAGAGCTCACGTCGCTCGCAACACTGCTCAAGTCGTCGCGGCTACGAAAGTTCAA
AGGCAAGTCCAAGGCGCGCCCCGACCTCGAGCCGTCCAACGCGATGCGGCAGTGGGCGCTGCCGATCCATACGCAGCCCACCACTGCCGCGCAAGAGAAG
GAAGACCACCCGGACATCAGCGACGACAACGACGTAGGTCGCATCAACCGGCAAGACACCATGTCTGAATTGGTAGCTCGGCGAGCTGGCGCGGCGCAAG
CAAGATGCGCTCACGGCCAACCACGGGCGCAACTTGATCCTGGACGAAGCGTGCCGCGCTGCGTTCACAAAGGACGCGGAGAACCGATCGCACCTCGAAC
TCCAATCGCTCAAAACGTGGTTTCTCAAAACGAAGCTCAAAACGTGCACTGATTTTGAGGCTTTGCAGCCCCTCGAGGTCGGCCAACTTCGGAAACAACG
CCATCTTATTGTTGAGAATGGTAGCTGACACTACTCTGCCGGCGTATGAAGCTCGCCACGTACTACCCCAACGAAGTCGTCTTCAAGCAGGTAGCGTGTT
ACAACGCGCTCTGTAGTCCATACTACATGGGTGCTAGGGCGACGATGGCGATGCGCTCTACATTATCTTTTCCGGCATGATCCTGAACGCATGTAGAATT
TGTCATATAGAAAAACAACTAGGGTCCGTGGACGTGCGCGTGAGCCAAAAAATTGGCGGCGAAGTAATCGAAGTTGTCGTGTGCGAACTGCACAAAGGTG
ATTTAGCCAATTCCACCAGAACATGTTGAACTATTGCATTTGGAAGGCGACTTTTTTGGCGAGCGAAGCCTCTTGCGCGACGAGCCACGCGCCGGTAAAC
CATGTCCGAGGTCAACTCCATTTTCAAACGGCAACTAGCGACGGTTGTCACCAAGACAATGACTGAACTCGTGTCCATCTGCCGCGAAGACTACAACGTC
ATGCTCAAGCAAGACCAGCAGGACTTTATTGATCGTGGAAAAGTCGCGCCTGCGATCGCCGCGGCGGTGCGACGAGTAGCATGCCCACTGTGTCTTTAAT
GGCACCATGTTTAGTCGTCCAACAGCCACGAGACGTACGTGCGCATTTTGCGCAAGAAGCCCAACTTGCGCACGAAAGCGGACGTCGCCCTCCTCACAAC
GTACATCGAGACCATCAAGTTCTTCCGCGCGCTCCCAAAAGCATTCCTGCGCGAACTCTGCAGCGTCATTGAGCTCGTGACGGTCGGACCCAACACGACC
ATCTTCCGCGAGGGCGAGGTCGGCAAGCTCTTTTACGTCATCATGACGGGGTCGGTCGACGTCAAAGTCAACTCGGTCGACCGGCGTGGCGGGAAAGGCC
AAATGAAGCTCATCAACCTCAGCGAAGGCGCGCACTTTGGCGAGCTCGCGCTCATGAAAGGTACGCACTCGTTCATGGACTCGAGACTACGCTGTCTAGC
CAACGGGCTCCGCTCGGCAACGGTCGTCACGACCCAGCTGTGTGAGCTGCTCATCATTGCCGAACACGACTACAACAACATTTTGCGCAAATTGCAAAAG
GAAGACATGTCCAAGCGTCTCGAGCTCCTGGATAAAATTCCCATGTTTCAAAGCGTCGAGTGGACCAACGAGCTCCTCGAAGAGATCTGCTATGTGCTCG
TCGAGCAACGGTTTCCCGCCGGCTCGACGCTGTACGCCCAAGGTTCGAAAAAGTTCGATGGGTATCATCTTGGACATTGATTGTCCAATATAGGGGACAA
GGCGATGCAAATGTACTTTGTGACGCGCGGCGAGTGCGTCCTCACGCGCACGGTGGTCGACCCCAAGACGCAAGTGGCGCACGAAACGACCATTGAGCGC
TTGGGCCCCTTCAACGTCGTTGGCGACGATGCGTACGTCCACTTGTAGTTAGTTAGTCCATTTATGGTGTATATCTAGCGCAACGGGTACCAACTTTAAC
GAAGTCATTTACCGCGCAGATACGGTCACGGCGACGACACCGATTGATGTACCACCTTGTCACGTCCATAGACTGTATATGCGTCCTCGCGTGTAGGCGC
TCGTGCTTACTAAATACGACGTCTTCAACCGCCTTTCACGGGGCGCGCGCGAGACGCTCTGGAGCCACACGCGTGCACACAAGGCCGCCATGGTGGTCAT
GGACCAGCTCTACAAGTCGCTCAAGTGGAAGGCCTACACGAAGCATGTGTTGGCCACCGAAGTTGATGGGCAAAAGTTGGCGCGGCGTCTTCGCCACCGC
CCCGCGCCGTCGCTCGACCCCATCGCGGTACTTAGGACCGATTGAGTGACAAGGACGCAAGAGATATTGAGTAGATGCGACCCAAGATGTCACTTCTCGA
AAGCAACGATTTGCTGCTCGTGACGCCGCCAACGTCGAGCCCGTCGTCGGCCATGACTCTCGCCAAGTACACGACGCAGTACAATCCCGACATCACCACC
GAAGACCGCGACCACGTCATGGCGCTGGCGAATGCCACCGAGTGTGCGGAACGCGCGGCGCGCGCGGCAGATGGCAACCCTGCCGAGTACTTGCGCTATT
TGCACGACAATGGTAGTAGTGTCCTTCAAACCATACACGAGCGGTGTGCGTAGGCGAGACGCCCAACGACGCCGTCAAAAGCATCATCAGTGAGAAGGAC
TACTTCTCCGAGCACTACATCTTTTCGATGACGACGCCGCCGCTGACGCCACGACCGCCGCCGGCCAAGAAGCCTCTGCATGCTGCCCGTGCGTCGCGCG
CCAACCTCGGCGTTCCCCGTGCACCGGTGCTGCTCGAGTTTGCCCCCAAGATTGTGGTCATCAACGTCGCCCACCAACGTCTCTTATTCTGTGACGAGAC
TTGTCGCTACTGACCATGATGGTGCTGCGTAGAGCTCCAGCCGGTCGCGCCCCACCCAGCGTTTCGACTCGCGGGGATGTTCGCGTCGAAAGAAGCCGCC
GAGACCGCAGCCAACGCCATCGAAGAGTACGAGGCCAAGCACGTGCGAAATGGCTTCAAGGCCGAGCGAGCGATCGGGTACTACACCATCGACACGGGCA
AGTATGTGCTCGTGCCGTCGACGCTTGAGTGCCTCCTCTCGCCGTACTACTGCGACCAAGCGCTGCATGGCATCATCGACGAGCACACAGACTGGAATTA
CTGGCGCTCGACGCGTACTGTCGTATCGTACATAGTGTAGATTGTGCTGACGTCGGGGGTAGGCGCCAAGCACTGCGCGTCCCGGCCCGTCACGGCAGAC
GCAATTCAAAAACTGCTGCACGACGCGTGTGGGCACGTGAGCCAAGTGGCCGCCAAGAAGAGCCAGCGACCTTCGGTAGCCAACCTTGCACTGTGTGATG
CTATGCTGCGCGACGACTAGTCGGTGGCGCGTTCGGTGCATTTGCACGACATTGTCGACTACCACATCCCAATCGAGCTCCGCGACGGCGGCAGCTTTGC
CTGCGTGAGCATCGTGCTCGTCGCCAAGGAAACGACCGAGCCCGTCCTCGCGGTGCACGGCTGCTTTCGCACCGAAGCCGACGCGCTGTCGTTCGCCGAG
CGCGGGTACCGTTTCGTGGTTGAAAGATTGATACAGACATGGACGTAGCAAGATTCCGCAGCTCGTCGATAGTGCCATGCTGTGTGTGGTGCCCATGTAC
GAGTGGGTATTTTTCGATGACGCGGCCGAGTGGTGTGTCTCGCTGCGCAAGTCGCGCGACCGCCAGCTCGGTTTCGACGCGCTCAAGAAGCAAGTCGCTT
CGCACCACGCGCACGGCGTCGCGGCGCTGCCCGAGGTGCCGCACCCGGTATACGTCCGGCGTCCTGCTGCATATGAGCGAGCGACAAAGCGTAGGTGCCA
ACGTGGGTCCAGGAAAAGGAGCAAGCGACCAAGATCCACCAACTCGTGTGCGTCCATCTCGGTCTGCGCCTGCCCGAGGCGGATATAGCCAA