Description :
From Genome Similarity Track
Location :
Scaffold_165:8788- 10528
Transcript NameFunction/comments
Phyta_totarag4897conserved hypothetical protein

Sequence
1740 bases(100 bases per row)
GCCATGCAGCTTCGGTTCCCATTGCCGGCCGGGTACTTCGCCAAGTTTGACTTGCACCCGAATGAGGCGCAGAAGTATCGGACGCTGGCGACCGATATCG
TCCGGGAGACGAAGCGAAATTTGGACCACTACATTAAGGACGGGCGTAACCTCATCGACGCGCACACGTGGAAACTCGCCAAGTCGAAGGAGCGACTGCA
CTGCTACCGAAAACGTAGCACTCAAGGCTCGTCGCACCAGCTCGGACTTTATGGCACTGCAGGAGCCGACGGAGACAACGAATCTATTGGCTATTCGTCA
CGTTCGCGTCCGTCGATGAGTGTCAGCAGTCGTTCAGGACACGAAGACATGGGCAACTTGTCGGTGTCGACTCGGTCgtcggacgacggcgaacCGAGTC
GCAAGAGCATTCAGCCGGCTGTGATCGGCTACGGCATCGCGGATGGGTCCGTGGACGACTTGGTCTACGGTCAGTACCAGTCCTCGAccgacgagatgaa
gacgctgtctGCTTTTCTGGGCGATGACTCACTGATTGACTGCGCAGTGCTGAAAACGATCCGTCAGACACGCTCCTCATACCTTGGGCTGAAGTGGAAG
CTGTCTCGCACGGTGGGTGGCAACCGAGACTGCTGCTATATGGAGTACGTCGGCGTGTCGGAGGATGCCAACGGCCAGCGCTTCGGATACCATGTACTCG
AGTCTGTGGTCGTTCGCAACTGCCCTCAGTTTGACGACAACTCGATCGTGCGCACCAACATgtccttctgcttcatcttccggCCGGGAAAACTGGCTGA
CCAGGTGGAGGTGTTCATGCAGGGCGCGTACGACTCATCGGCCGACGTACTCACAGCTGGTGGAGTGGGCGACTACCGCAGCACTATGGACATGCTGTTT
AATCTCCCCACTGCAATGGTAGGAGCCGAGGCGAAGAAGATTTCGGCTATGGTAGCCAAACAGTCAGGTGCACTGCGTGgtgcgagcagcaagaaccaGA
GTGGCAACCACTGCTCTATCTGTCGTGCCAAGTCAGGTTTGTTGTCCTCGCACACAAACTGCCAGACTTGTGGCGCCGTCATCTGCAGTAAGTGCCACAT
CCGGAAGGTGACATTTTCACGTCGGGGCAAGATCAAGGTCTTTTGCTGCAAGATGTGCATGGTCATGGTCAAGGACCAGTCGCCTTTCGCAGGCGaacag
ctcgagcagcagccagcaaagCCGAAGAAGGTGTCTCGCGAGGACAGCCGCAGCAGGattggcagcaacagcagcaacaacaccagACTGGATACGATTA
ACGCGTCCATCTCGACGATGTCCCTCACGGACTCCGAGTTCTCGTCGTCATATCAGTCGTGGCAATCCAGTTCAGTGTCGTCGTTGCAGTCGGACcacga
cgacagcttctACAGCTCGAGTGGCCCTAGTACTGCTATGGTTCCGCTTGATAGGAAGATGCCAGCGCTGATGGAGGGTGAACTACCACCGCAGCCCTCT
ATGACGTACCaaatcgagcagcagcgccaatacgagcagcagcagttccaacagcagcagttcttGATACGGCAGCGCATGAAGCAGAACGCTGACCCGA
GCATTCCCCCAACGCCGAGTCAGCGACAGCCTGCGACTCGCGAGGGGTTGTACAACCAAATGCTAGAGTTGCAGATGCAGGCCGAGCGGGCCTACAACTT
GACCAACCAGAATGCCAACATGATGAACCCGAGGCGATAG