Description :
From Genome Similarity Track
Location :
Scaffold_116:87863- 90481
Sequence
2618 bases(100 bases per row)
GAGATAAACCCATCTTTGCTTCTGGATGAATCTGTCCTCAAGGACACGAAGGCGGCAGCTAGTGCGCGTTGTAGATTGTTAAATCAAATCCTTACGATCC
TTCCTATCCTTTGTTTAGGGATTTCATGACGATGTGTGTCCCAATCCACCCTCGGTCTTACCTCCAGATAAAATTGTACGTCATTAATTTAACTTGATTC
TTCGAAACAATGTTGTGTTACACAATATTACCCCTTACCGGAGGAACATTGTGATGTCATTTACGACTTCCTTCGTGCAAAGGACGTGGCAGGTACAGTA
CGTGAGAGTAAATCTCCGCACTCAGCATCTTTATATTGTGTCAACCAGCTGAATGGTATGAGGCGCATTGTACATTCTTATGACAAGCTTAATGCATCCA
CTATTCCGGAACAGACACCCTTTCGTCAAAAGAAATTTATCCAGAACAATATGGTTGGTTGCTCTCTGTACAGTGCTCTCGATTTAGTAGAGACGCAACT
TTTTTCGTACCCATCGGGATCACGCACATACATATTTTAATATATTTTTGTTCGTCATCGTGCAGAACAGGGACGGTCGGATGTTAAAATCATAGTGACC
ATTTACGACCAGTACTTGATTGCATGCGCACAAATAGGTATTAGGCCAACGAATTTGTATGCATCTTCGGTTCTTAGGAGATTGCCTTTCTAGGATGCTT
GATTAGGAAATGCAGACTAAGATCGAACCTCGTTAAGTTCAAAGCTATAGTTGACTGGCCGATTCCTAAGCATCAAATAGACTTACGGAAGTGGCTTGAC
CTTTCCAATTACTTATATAGAGATAATTACGCTCATATGGCTAGGACGTTCACCAATCTTCTTTAGAAGGATACGAAGTGGTGTTGGGATACCATACATG
CTAACGCTTTCTGTGTAGTTCAGGAGATTCTTCGACTACATGCTACTATTAAATCTCTAACTTATCCTGATTACTCTTTCATTTTCTTTTGTAACCCATT
TAATTTTGCTATCGGCAGTGCTCTGTTACAAACCGATGATGAAGGCCGTGAGTGTGGTCGCCTTGCTCTAGTTAAATTTCGATTTCATCTGCTTACTTAC
ATCTAAGCCGTTCATCCTTTAGAATGACCATGCGTCTTTAAGTACGGCGGTACATTCGCCTCACCGCTCTCAGAGAATGGCTCGTTTGATTTCATTTTTT
TGCCGAACTTCGAGGTGCAGTATAAGACGGGAAAACAGATGTATTAGCAAATGAGCTGTCCCGCAGCCCTAATTTTAAGCTTGCCCGTGTACGACTTCGT
CGTCGCCCATAGTAGATTTGGTTCGTGCTGCATATACACACGATAATCAATGAGTGACATTGAAACGTGCTCTTAAGAGTGACGCATACATATACTTGAA
CGTTAAGTTTTCGGCACGGTTACTTCTTATCCTACATCTATATTGCACCTATCGTGGCCTATTGGGCTATCGCACGAAGTAACGGATGACCGTCGCATCA
TCGTGCCTCACGATGGGGATTTAAAGTATTGAATCGTCGTAATGCCCTTTATACTGCTCTCAGTGAGAATTGGGGCCGGGGAAATACTTAAGGCTCTGTG
AGCACCACTGGTGGCCCAAACTGTACAAATAGATGTGCCCATATGTGAGCACATGTAAAACGTGTGAACGGGTCACACCCACAATCGGCTAAGTGCTCGC
AAATTTTTATGGACCCACTGCGTGTTGGGGGTCCATCAGCATGAACTTCGTGTTCGGTCTCCCTATAGTCAGAGACGACAACACAGGCATTGTGGTCTTT
TTTGATCATTTGAGCAAGATGGCCCACTTAGCGACTGTGCCGGACTCCATCGATGGTAAAGATACAGCTATTCTGTTTATCGATTGTGCGTTTTTTTCAA
CAAGGTTTGCCGGTGGTAAATTGTCTTTGATTTAGAAACCGGTTCACTAAGGTTTTGGACTTCCATCTTTAAGATGCTTGGCACCAGATTGGACATGTCC
ACAGCGGACCGGCCGCAGACTCATGATCAAACTTATCGAGTAAATAGAATCGTTGGCGATGGTTTTTGCAGTGTTTGTGCTGAGTCGCCGAAAGGTCGGA
GCTCATAACTTCCTGTCATTAACTTGCGTACAAAAAAAACAATGCCGTTCATGCCTCTATCGGATTTACCTTTTTCTACGTGAGTAGTATCACACACCCG
CGCGTCCCTTTAAAGCTACTACTGCGTGGATCTGACCTTGGTGGTGAAGAGTTTGCCTACAAGCTTTCTGGAAGCTCTACCACTATGCAGAAACAACTGA
GCGAGTTTCTCGCAACGCGCTTGAGCGTCTTACGACAATATCGTGATACAAAGGCTGATAGACAAGATAAACAAAAGATCCAGATGATACTAAGTGAATA
GGTGTATTGATTCTTATGAAGTGGAGACCAAGTCTTACTAAACACTACAGACCTTCCTACAAATGTAGTGTCTGCCGTCTTCAAGACAAAATTGCGTCCG
CTTTATTGGGCCGTTCATGGTCATTGATAAGAAAGGCCTTGATTATACGCTAAATCTTTCGCGCAAGATGTGCACACCCAGTATTCTACGCTGGTTTACT
TAAGCCGTATCAGGATCC