Description :
From Genome Similarity Track
Location :
Scaffold_71:8784- 9910
Sequence
1126 bases(100 bases per row)
CATGTGAAGTGTTTAATGCCAGCATCAAGCGCTATACGCAGCGCAAGGCAGCAGATACGCGCCGTTTGTTGATGAAGCTACTGACGATTGCAGAAGATTA
TTCGCTGTGTGTACCACCTCCCATGGCATCTGGACCAAACGCCCCGCCTCAAGTTGCAAAGCAGCTGGCCCGAACGTTAGTGTCGACCAACCGAGTCGTC
GTTTACGCTACGACCGAGAAGTCGGTTGTTCGCGTGCTATATCATTGCGGTGGTCATTTGGAAGACCGCTCCGAACTGTCTGATCTTGACGAGTTGGAGG
CCCCCAGCAACGTCAAAACTCCTGTCATCATATCGCCCGAGTGTTTAACAGGTGCAGAAAAGGCTACCGCTGCCAAGTTCTATCAGGAAGCTGTGAAATG
GTCTGTACGCCGCGCGCACCACGTTGGCATGCCACGAGGCGGGTGGGCGGTGCACCTGAGTACGTTTGAGTGCTCATGTATTTTCTATAAGAAGTTCCTG
TCTTGTGCCCACATAATCTGTGGACTTGCGGCTTACGGACTCAGCGTTCCAGGAGTTAATGGGTCCAATTTAAGATTCAAGGATAGGCGTGTGCGCCAGA
AGCGTCCACAAGTGAGCAGTGCGGCTACAGTGCATGTAGATGATTCAGCTACCGGTTTACTGCTGGCAGCCAACGAAGTGTCGCTGCATGGCAATCACAC
CGGGTCCGATCTCAGGAGACATGCGCATAACTTCCCAGCTCAAAGTCTTGGTGTGGTCGGGGCAGAAGTCGGGTTCAATATTGGCTTCGCGCCTGGTTTC
AACCTTTGTCCGCAAGATCACACCAGATACACAGCATATGCCTACAGACCAACTGGTTACACGGCGACTTTACCAGACCCGGTGGCTTTCCAGCTCGATC
CACAGCATTTCCAGCCTCTCTACCCGCCGATTGCACGGCCAAGTCCTGCAGCTCCCCCATATTCATTTCAGACTGGTTTGGCGACTTGGCAAGAAACATT
TACCAGTTCTGGGCCATATGTATGGTCTACGTCAACCACATCTGAGCATTTGCCACTTCCAACCGAGCCCGTCCCCATCAGACGCCAAATTGGCCGTCCC
CCCTGGCCACGGCGGCCCTCGACATG