Description :
From Genome Similarity Track
Location :
Scaffold_430:8782- 9924
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_430-fgenesh-gene-0.16-pyruvoyl tetrahydrobiopterin synthase

Sequence
1142 bases(100 bases per row)
CACCGCCGTCCGCGCTTGATTCTGCATCGCCGTCGTTAGCGAACGCTGGGTCCGCGAACCTGCAGCTGAGCGCCGGCAGCGCCACTGACGAGGCCGGCGA
TTCCGACCATTTGCCCCATAAGAAGCGCCAGAAGAAAATGCCCAGTGGCCACAACGCGCTGTCGAAAGAGTTAACTGCGGAGCAAAAGGCGATCGTCAAA
ATGAACGTCACGCGCGACGCCACGACCGACGGCTTTGTCAAGTGCTGCTACTGCGAAAAGGAGATCTCGTCCAAGAACGTTGATCGCTGGGCCTCGCACT
TGCGCGGCTGCCTCAAGGCACCGGAAGAAGTTAAGGCGCAAATCCAGCCATTCCGCCCTGCGGCACAGGCAGCAATTCTCGGTGCAGCAGGCACGACTCC
CTCCACCTCGGCTCCTGTGCCAGGCGGTCTCGCGTTGACTGCCCCATCTCTCGGACTGCACACTGCTGCAGTCGGAAGCCCTGCGACTACTGCCGCTGGA
GCCGGTACTGGCGTTGCACCGACGGGTCAACTGATGACGGGCGCGATTGGAGGCATTGCACCGGCCGTGTTGACGTCAGGGTATAATGAGGTCTTCAAGG
TGCACGTGTCGAAAGACTATATGAAGTTCAATGCGGCCCACTTTATCGCCTATAAGGGGTTCCGCGAGCGTCTCCACGGCCACAACTACCGCGTCGCCGT
TACGATCACGGGCACCGTTGGTCCTGACGGATATGTTGTGGACTTTGGTGAGATCAAGAAGATTGCGCGAGTGATCTGCAAGGACCTGAACGAGTCGTTC
CTCGTCCCCATGAACAGCGATGCACTCAAGGTATGAACGGTCTCTGGTCGTGGGTCTACACTTCCCATATTGGAATCTGACGCTCTTCGGTCTGCTGTGT
AGATCTCGTTTGACGGCACCAACGTGCACATTGTCACGGAAGATAACGCCAAGTTCAGGTCCGTCCCTCCATGATTCCGGTGATCATCATCAGACGTACG
CTAACTTGTTGCTAACTTCCACGCTGTACAGCTTCCCAAAGTCCGACTGCTCGTTGCTCCCGATCATCCACTCGTCTGCGGAAGAGCTCGCCATCTATAT
CGTACGTCAAGCTGACTACACGGTGACTGTTTTTATGCTGTT