Description :
From Genome Similarity Track
Location :
Scaffold_1093:878- 2320
Transcript NameFunction/comments
Phyag_g9457phospholipase D, Pi-PXTM-PLD

Sequence
1442 bases(100 bases per row)
TCCATCGGCTTGGGCAGCGTCGCGAGTGTAACCAGTTACAGATCCAGTGAGTTagaggaggtggacgtggacaCCTTGGCGGAGGAAGAGTGCGTGCTGG
AAGACCCGAACGACGGGGAGATGACGATCatgaacgacgacgatgcagagctcagcgaggaggaagaagaagtgatGGAGCACTCCATCGACTTCTCCGT
CAACAGAGCTACAGTCACTCGCGCGGGGGTCATCCCCTGCTGTGTCTTTGTAGGCCGTGTACGCTGGGGTACCACGGACTGGGAGATCTACTTTGGTCAG
AAACAACTGCTGAGACTGCATCTCAACCTGCACATCTACTGTCTGCTGAACAGACACAAGTTGATGCGGGGCGTGCATTTGCCGTGGACGATCTGGCGCG
AAAAGCGCGCTGAAAAACGCGTCCTCGACGTGTATGTGGTGCAGGATTACATTAGAGCATTGTTGAAGGACAGAGATCTGAGGAATTccgagccgctgct
gtcgttcttGGAGGTGAGTCCGTCTCGCGCGATGCTGAGATTGGGGCCGTCGCTGAAAGAAGGGTATGTGCACATGCGCATCAACGGACCGTTCCAGTTG
CCGCTGTACACGTGCTTTAACCGCACAATTGAGGCGCTGTATCGGCATCTGTACCGCGCGTGGATGCGCATTGCGTTCGTGTCGGCTATTGTGGGCTTTA
TTTTCCCGATCTGTCTGGTGATCGTGACGAGTCTGCCGACGTTCTTTTCTCCGCAGAAAGAGCTGGTGAACTCTGATGAGGGCACCAAGGAGGTGTCCAC
GAAGTTGAACACGGCTGGCGTGTTCTTGGGTCTGGCGGTGTTAGGAGGCATCATCTTTTTTGCTGGATTCGTGTACAAGTTTTTCCAGCATCGACTTGGT
GTTATCCGACGATGGGTGGTGCTGAAACCTTCGTGCTTTGCTGCGTATCGGAATCGGAACGACCGTGAGCCCAGCGAGGTATTCTTGTTCGACAAGACGT
TTACAGCAAGAAAAGGAAGCTACAGACAGGGAGTGAGCTGGATGCCGAGTGGCTTGGTCGTGGGCAGCAAGGCTGGTGATATCGAGATTGACACTGGACA
TTACTACACGCGACTGACGGCGTTCATAGCACTTATGGGTGTTTGTTACGGCATCATGCGCCTTTCGAACAACATTTACGAGTTTGACTACCTCACATTG
GACAAGAGCTTGGGTGTGCCTTTTACGAATGCATCCGGATACGAGAATTGGAATCAAAGCAGCGAGATTCAGTACTGTGGCTATTACTTTACCGTGCCGG
AAGGAATCACGGTGTACGTCGAGAGTAACGACGATAACGCTGTGATCTCGCAGCTACAGATGCCATCGTCTAATTCGATGACGGCAAACCTTGGATACTT
TTGGCAAAGCGACAGCATGGGATACAGTTTGAACGTGATCAC