Description :
From Genome Similarity Track
Location :
Scaffold_3904:878- 1972
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3904-snap-gene-0.0Transposase

Sequence
1094 bases(100 bases per row)
CAATGGTCAAAGCTCCCGCAAGCCCTTCCTCTCCAAAGTCCACAAGCAAAAAGCCTGGCGTACGCCAAACGGATGCTGGTAGCGCTTCCAGGTGTGGACG
ACTGGCGTGACGTCCTCTTCTCGGACGAGGCGTCAGTGTAGCTCCACGGGTCGTCGGGGAAAGTGAGCGTGTGGCGACGCACGCACAAAGCACTTACGGG
AAGCTGCACCGTTCCAACGTACAAGAACGTTTGCATGTCGCTTATGGTGTGGAGTGCCGTTTTCTCTAAAGGAGTTGGCACTATTCATTTATGCGAGCGG
TCTGTCAATGGTGATTACTATCGCAGCATACTCGAACGTGAGATTCCGTCCACGAGAGAGCTGCGTGGGCTCCCATCGCCACGCCATTCGTAGAGGATAA
TGCTCCCACCCACTGCGCAAAGCTCACGCAGGAGTGCGTCACTAGCTTGTCTCTGAACGATTTCAAACATCCTCCTCAAAGCCCAGACCTGAACCCAATC
GAAAACCTTTGGACGGTTATGAAGTCTGAGCTCCGCAAAGACCCAGCGATAAATATCGACGATTTAATGGTGAAGTTGAAGCGCATTTGGCACAGCATAT
ATAACGATGTGGTACAGCGTTGCTACTTGTCGATGCTGAAGCGGCTTGCGCAAGTTGTAGCAACAAAAGGAGGCAGCATCAAGTATTAGAGGCCATCAAC
AGATTTAATCTTGGTTCATGTATTGATTTTTTGTATGGAAATTCATACAGAGCAGTACATAACCTTTCAAATACGTTTCAAACTGGTTTTAGAGTTATCA
CATCCCTATCTCTTTATCTCCAAAGCAATTTTCGTGTAGCCTTTACAAATTATAAATATCATCACTAATTTTTAGAGCAATCAGACAGAACCAAAACCAA
GTTTCCTGTTTGACACGAACAACAGAGCTAAAATTTAACCGAGTGCGCACTGAAATGAGCACTATTGTCCGCACCACGACTCGTTGGTTTTTGTTAGCGG
GTCGGTATTTAATACACCTTCAATATTTGGTATTTTCGATGGAAAAAAAACATTCTATAGATTGGACAATTCGTAACGTTATGGATATGAGCTG