Description :
From Genome Similarity Track
Location :
Scaffold_4505:878- 1918
Sequence
1040 bases(100 bases per row)
CATCCACGCATACGCCATCCGCATCTTGAAGCGGTCGCGCAAGCTCGCTGATGTCGTAAGGGAGTTGACGTTCCACTCGTTCCGTCGCGGTGGCGCCCAG
AACGCGAGCGGCGATCACCAACTCAACGCGCAATGTATACTCGACTGTGGTGTGTGGAGTCTAACGACCACGAGTAAGGCATTCGCGTACGTGTTTGATA
CGGAAGACCAACAGATCGCGCGTGTCTTGAGGCGATGGAAGGTGGGCTAGTGAGTCCAGATTGCGTCGCTCGCTATCTTTGACAGTCAGACGAAGGCGAA
GGTCGGGCGTCTGCACACGCTTCTCTTCGCGACAATTACAAGTCAAACCACCTCGACCCTTGCCGTCAATCAGCAAGTGCTCGACACTTGTGCCGCGTTC
CTACTGCGCGAGCCGAGTGGAGAGTCGCCTGCTGCCAAAGGAGTCGAGGAATGATGCCGCGAAGCTAGTCTGCAGCTGAGCGATTTGATGTCGCGGTCAC
GAGCTATAGATAACGCACCATGGAATCGGCGTTATTGTATCAGCTGACAACAAGCAAACGAAGCAACAATGCGTCCAAGCGACATGAGACCATCAAACAA
TCAAGTACCAAGCGGCTGTCATTGACGGCCTCATTGAGGCAGTTGAGTTTACGGCTAGGAAGCGAAGTACTTGGATATATTTGTCGATCTTAAAATATAG
TTCAGTGGATATATGGGAATCCTCTATCCTTGGTAAAGCCCGAAATCACAGGTCAACCCACATTTTTTGGGCATCTAAAAATGTTGAGCACCAATTAATG
CGTAACACACAATTGCACAAACGCAGTATTCGTATACACACTAAAAACGAAAAAAGGCGCCCAAAACACGGGAAAAAATCGTGTTTAGTACGTCAACAAA
CCTGTTTTAAATATTTATCAAAATCTTCTCAGATCTGCCACCATTTATCAGTATTCTTCCAATTCAGTATTTTAGATTATCAAGCTTTGCGATTGGTTGA
AGTGAAAATAGGTGACAATCCAACTTTAAAAACGCATGCA