Description :
From Genome Similarity Track
Location :
contig_129:8778- 15673
Transcript NameFunction/comments
g13606.t1hypothetical protein
g13607.t1hypothetical protein

Sequence
6895 bases(100 bases per row)
TTCACACGGTCAAGCGGATGCAGGAGGTGACTAAGGAGAAGCGCTTCAAGGAGCACAGGAGTAGTCTGAAGCTAGCTGCACTTAGCGAGGCAGAAGAGCA
GCAGCTGCGGACGGAGTGGAAGGATGAACCGGCACAGGGACTACTGGAGAGATACCAAGGACTGGTGAGCTACTGGGCTGAAGTCAGTGCGGAGCACAGG
CAGAGGTTCAATTTTCTGATGAAGGAATGGGTGCTGCAGAAGGCGTTAACGCAAGCGGAAATGGAGAGGCGGATCCAGTTCTTCCAGTTCGAAGAGACAC
AAGAAGATAAGAAACTGCCAGTAGGAATGGTAGTCGTATAAAGTTGCAGTGAGCAAAGGGATGGCAGTGGGCGGGAACTGGCAGCTGACGGTTGATCAAG
AGCGGTTGAATGTCCTGTGCGTGACTCCGTTTCCGAAAGTGACTAAACTGCGGCCAAGGACGGAAGACGAGGACATGGCACTTCTGATGCTACTCAATCA
TGAGATCGAAGTGCCGCACGTTCCAAGCTTCTTAGGACAGTCAATGACGGCGCGTGAATTAGCGCTATTCTCGAACATATTTTTAGCGATTGAATATCCT
GTGTACGCGCACTTGGCACCGGGACAGAGATTTGGCGACAACCTGTCGAAACACGTGCTATTAGCGCAAATCCACTCAGGAGCGGAGGCGGCGATGCCTC
AGCGGCAGGAAATCATGGAGTTTAAGGCGACCATGTCGAGAATCTCTCTTGACATGAATTCGAGAGTGTTGAAAGTTACTCTCAAAGGGAGACACACAGC
AAGCAAATGGATTGGATGGAAGGTGCCATTTGCCAGGAAAATGCTGACACTGCTGGACTACGAAGCTCAGAGAGAAGATGCGAAGTTGACGCATGAATTG
ATCAAACTTGATTATGACTCATTCTCAGTAGCGGTATGCAGAGGAGTAGTATCATCGAAGGAGCTATACTGGATCATCGCAAGCGGAGCTGGGTTGCAAG
TGCAATCCATGAGGAATCTGGAGGTCGGTCAACAAGGGATGGATGATCAGCAATGGAATGTCAAGATACGAGCAGTGGCGTGCCCAGAGAAACTAAAGGA
GATTGCGTACTTGGCGGTTGATGGCGTTGAGATTGTTGTGCATCACCATGAGGTGCACGTCAACTGGCCTTGCAGGGATTGCTATTCACCGGACCATCCG
ACCAAATTTCGCAGGACGAACCAAGGAGAGTTGAAGATCAGGAGGGCTCATCACACATACAGTATCGAAGGACGGCTACCATCGAAGAAGGTATCACTAA
ACAAAGGATACGATGTGGGGAGCCACCCGACTACTTTGGAACAGCTGAACGTGCTGTTAAGACCTGACATCACCAAGCAAAGCAAAAGGGCGGAGAAAGA
AAAGAAGGCGGTGGAGCAGAATGCCAAGGACCCACCTTGTGATGTGGATGTGCCAAAAGAGGAGGGACCAGTGCTACCTGCGGAGTGGCAGCAGCACAAA
CCATTGCATGGCGAAGACAATAGCAAATGAAGTGCCACAATAGGCGATGGAGGGAGCAGGGTCATAGCTGACAAGAAACTAAGCGAGGGGAGGGACACGG
AGAGCCATGGCGGCGCAGAAGGGGAGCATCGACGGTCTGGGCCGCATACTGTGAAGGCAAGACTGAGGACATGGCTCCGGATATGGAGATGGGTGAGGGG
ACGGCCGAAGATAATGACTTGGTTGAACCAGAGGAGGATTGCGTTGGGGAACATCTGAAAGAGGGCCCTACAGTGGACGAGCGGCCCAGAGAAAGGTCGC
CAACGCGGAAATGGGTGATCTCATCGCGACAACTAAGGTACAGCAAAGATGCCAACTCGACTGGAGTAGGCAGTTTAAGATGGAAAGCTAGCGACAAGAT
CAACCCACAATGAGGTCAAGAGCAAGGGTACAGAGAACTCACCCAAACGCCGGTGGTCAAGCGCCCAGCTTCATTGTCGCCCAAGAGACGTGCGCCAGAG
GAATGGGACAGTGAGCGACCGGGGAGAAGCAAGGAGCAGAGAGGCAAATAGCTACAAAATGCTCCAAGACGATGGAAGACCAGGTCGTTATCTCCACGTA
GAACGACAATGGCAGACAAAGGGCTCAAAGGGAGCCTGCGCCACCAGTTGTTTATGCACCAGTATCTGCATGAGGTGAGCGAAAGGAAGAAGACGGGCGA
GGAGTTTAGTGCGATGAAGCCACAGACACACGCGGAATTTCACGAGGTAGCGGAACAGCACACAGAAGTGGGGAAGGTGGTGAAAGCGCGGTGCGGGGGC
GACCTGAGCGAGGACGGCAGTGATGACGGAAACGATGACATCAAGGTCATCAAGGTGACACCAGTCACGGATGCAGAGGCACCACTGGAGGAGTGGTTGA
CGCTCATTGAAGGGCGGATAGTGGATGTGGCAGCCCAGACCAGTGTGGTTGGCTAGCATTCTCTATGCAGCACTTACGAATTTCAGCGAAGGACTGTTGA
CACTCTGATGCAAAAATTGCGGGGGAGGCCAACAATCTCAGGAAGCAAGTCATCAATGGCATGTTGGCCAACCTGGTGGATGAGAGTGGATTGCATCCAG
TGGAATTGATGGTGGAATTGGACGTGATTGGAGTAAAGATCAAGGAGGTGGCCAACTGGGAAGAACAAATTTACGCGTTAGCCAACCACTATGCGAAGCA
GCGACAAAAGTCGGTGAAGGTGCTGGTTCCTCTGCACTATTGGGTGCGACCTGCGCACATCAAGGCGATGACAATGCACGCCAGAGAGACGTTGTATGTG
TTGCATGTGGAGGAGAACGGCATGGCAAGGACTCAAGTCTATGCTTACCACAACGTGCGTATCTCAACAGACGACTACATTGAATCGGGTACAGTGGAGA
CAATGGACACCAGAGACGCGATGCAGCTTTTCAGGGCTCTGACCCAGGGCGGAATACTGCCAACGGTGCTAATTTTGCAATGGCTGAACACGGGTAATCA
TTTCCAAGCAGTAATTTATGACCAGGACAAGTACGCAGCTTACACAAAGCGGACGGACGGAATGGAGAAGACAAGGAACAAGATCTTAGCGAATAGTGGA
CGCGTCGAGCTGGACGCAGAACCATACGATCACTTGAAGACTACCAAAGCGGCAGTGCGTAAGCTCAAGGGCACCCGCAAAGCCGCCAGAGTGCTGTACA
GCAGGACGGCCAGCATGGACAGCAGAGTGGAAAGCAACTCGAGTAGCGAGGCGACGGAAGGCGACCGAGACAGTGAATGGGCCAGAGCTCAAGATCACGT
CAGGGGAAGGGAGCGAGCGGCAGTTGAAGATGCGCCCGGAGAAGTGGATACTCAAGCGGACAATGAAAGGAGGACGACAGCTGCCAGACTGCTGCCACAA
AACACGATGGCAGTGGAGAAGGGGCAAGGGCGGAATGAGCTACCCGGCCATGCTGCCCAAGAACATGATGTCGCAAGTTATGGCGGGGGATCTCATCACA
GAAGTTTCCTCACTGGGAGAGAAGGGGAGAGCTGAGGGGCCTACAGGAGATGGAGCACTGGAGGTATGCCAGCACGGTGACAGCAGAGTGTCCAATGACC
AGTAACACAGAGATTCACACAAGGAGGAGGCTGTCATACTTTCACAGTCGACAATCTCTTCCTTCTATGGGAGAGTAACGAAAGTGGAAACGAGCGAAAG
GAGGAAAATGGAGTTCAGATGATGCAAAGCGAAGGCAAAGATCTGAAGTCAGCAGAAACAAGAAATCAAACCACTGCTATCAACACAAAATGACAGAACA
CTGGGCTTAACCACCATCAATGTTCGGGGTTTGGCCACACATATGGCACACCTAGGACGTAAACTGCATGGCACTAAGGAAAAACATGAGCGAGGACAGA
GAGACATTGTCTTTCTACAGGAGACGCACCTGCACGAGGAAGAGAATGGAGCAGCGCGGAATCAACACGCAGCCATGTGGGGCTTTAAACACAACAGAGC
AAACAACTTCTCTTTCTGGTCGTCAGGGGAGAATAGAAGAGCAGGGGTAGCGATTCTTATCAATCCGTATGGAGAGCTGCAGGAAGCGATGCCATGGGGA
ACGGAACACTGGACGGAGCATCTAATAATGATCTCAGGAGATTTAGCGGGGCAGAAGTGCATTTTTGTGAACATATATACGCCATCAGCGGGAGACGTGC
GGGTCCAATTCCTACAGCAACTACAAACGATCGAATTTCCGGCCACAACAATGATAGTATGTGGAGGATATTTCAACTGTGTGGAGCAACGAAATATGGA
TAGGATAGAGGGAGACAGTAGAGACGATTTTGGGGCAGCACAGGTGGTGGCCAAATGGCGCCTAGTGGACGCCAGATTCTACAATTTACCAGCGAAGAAA
GGAGAGTAGGACATCAAACAATACGCAATTGAGCATCACACTCACACCCACAAAACGGTAAGTGAAGTTATAGGGTCCTCACGACTGGACAAATGATATG
TAAGGGCTGAGATCAAGAGACTGGTGAGGGGAGTGACAGCGGAAGAATTACCCTGCGGAGTAGACCACAGAGCCGTCTTGATGGAGTTGCATCAACCACA
AGGAGCCATCAGGCTGAAGAAACGGTCGAAGATTTACCCTCCGCCGGCCTATGTGCAGATGACGATGACCAGCATGATTAGGAGGAGGTTAGAAGAGCAC
AGGATGGAGCAGGATCAAGTTGCGGTGCTGGAGACAGGGGACAATTGGGACAATTTCAAGAGGGCGATCAAGACAGATATGACAGAACTTAAGAAACAAG
CGCGGAAGCGCATGAGTGACAGCTTTAGACAACACATCCGGAGGATCAAGAACAGGCTGGGGCGATGCGCCGGAGACGGAAAGGAAGGAACTGCTGGGGC
AACTGCAGAAGGAGCAGGATGGAAAGAGGACGCTGAGGCGAAGAGTTTTGATAGCCAGGAATGCCTGGACATCAAAATGTAACACGCGGCACTTCTTCCA
GAGAATATGCACTAAATACGGAGACAACGTCATACCCACGCTGATCCCCAAGCAGGGTGTCACCCATCGCAAGCAACAGGTCAAAGCGGACATTTTAGCA
GATTACTGGGAGCCGATTCTAAGTGGGGCAGCAGTGGAACAGGTCTCTATCGAGGAATATGTGGACAACATTGTGAGCAACTGGGAGACGGAGGATCTCA
CGGACATTGATGAAGACATTACCGAAGGAGAGGTCGAGCGAGCGATACACAAAAGCAAAAGAGGCAAGGCCTGTGGGCCGGATGACCTGGGGACAAGGAC
AACAGTGAGTCGGTGGTGCCGATCTTAACGAGGATACTGAATGGCTGCATGGAAACCGGATTGACCCCGTCCACATCTGTGGAAGCCTTCATTTTCAGCA
TCAGCAAATGAGGAGACAAAAGCAACCCATTGAACTATCGGCCCATATCGCTACTGAACTCGGACTACAAAATATTTACTAGGATCCTTGCGTGGCGAGT
ACGGCGGCACATCACGAAATTGGTACACAGGACACAACGCGGGTTCATTCCAGGTAGAACAAATTCATGAAGCGATTGACATGCATGAAGCGGCCAATGC
TGCATGTAGAGAGGGGCGAGAGTTGACGGACGCGCAGGTGCTGTTGCTCGACTTCGTGAAAGCCTACGATTCGCTTGATAGGGCGTTTTTGATGGAGGAA
GGGGCTGCCACCTAGGTTTTGCGCAAGAGTGGCGGCAATTCACGCCAACACCACAGTCATGTTTATGGCGAATGGGGAGTTTTCGAGGGCGGTCAAGGTG
ACAAAAGGCATACGGCAGGGTTGCCCACTTGCTCCGCTGCTATTTATTCTGGCGGTTGACCTGCTCTACGATGAAATAAAAGAGTGACGGTAGACTCAGA
GGTATTGCACTAGTCAGCGGTAGTGACGCGAGGCCTTTGAAAGTGGTTGGGTACGCCGATGATACGGCCATTTACATTGCACATCGAGCTATGCAAGAAG
CAGAAATACAGACCATAGCACGTTTCTCGGCATGTTCGGTATTACAACTCAGTAGTGGTAGGAGACAGCACCTTAATTTTAAGGCTGATGGAGACGCGGA
AGGAGCCGACATCGAAGAACCTGATACACTGGTACAAGCGAACAAGGCGTCTCGCGGATGAGTAGCTGGCAGCACAACTATCGCGCACACAACAATATGG
CGGATTGGTTGGCCAACCAGGCCATGGATCGAGGAGCCAGCACGATGAACGCTCGAGAACCAAACGGTGAGATGTTGCCGCTACTGACAGGGGTGACGGA
GAGAGCAGACAACGATGCCAAACAATGGACAGACAGAAGGAGAAGAGGTCGGAAGGTGGAGAACGGAGAAACGGAGAAGCGGAGATGCTAGAAGGAAGTC
AGGAAGTGGGTGGTGGCGGAGGAAGAGAAGCGCGCAACCACCCAGTACTGGATCAGGCACCAAGTCGATCTGGAGTGGTGATTAGAGTTCAAGACCCAGG
TCTTGTAACACAATACACATCACCCGTTGAAAATAAAAGTGTTACTCAAGGTCAGTGAGTTTCGCAAATGAACCGCGAAGTGCACATTTGGGAAAGTGCT
GTTGCCAAGTGATTTTATCACGGTAACATGATCACAGTGGAGAAACAGGGTATCGATCCCTGTATCCCGTATTGCGACTTGGATCTTCAATTCGATGGTC
CTTTATTCCTCTCGGCTCGATTTTGGGTAAAGAAGCACTCGTTCCAGTCCGCTCAGCTACTCTCGGGTCTCTGGTATTGCGTACATAAAAGATGAGTACA
CCACCTACATATAAAGTTTAAGATACAACTTACCTTCGAGTCTCTTGAATTTCTTAGCAGCACTCTGACTGCGGGTGAGCGCTGACACGCTTGGT