Description :
From Genome Similarity Track
Location :
contig_9:87762- 89328
Transcript NameFunction/comments
g2587.t1hypothetical protein

Sequence
1566 bases(100 bases per row)
AAGGTGGAGCGCTTCGGCAGGGCGGTGAGGTTGACATCTGGAAGCGCAACTACATCGGACTCGTTGTGCAGTATGCCGCGGTGGGTATGATCTTCGGTAC
GCTGCCCGGCACAGTCTATCCGTTCCTCTTCAACTACCTCAACATGGAAGGCACACAAGTCGTGTCGGCTGTGGTTCTGCTCAACATGCCGTGGTCGTTC
AAGATTTTTTACGGCATGATCACGACTGTGTTCCTATCTGGGGCTACAGACGTCGTCCGTTCATGGTCATGGGGTGGACGTTGTGTTTTACGATGCTAGT
CGTTATGGCTGCATGGATGCCGGCGACCCTTATTACCCAGACAACAAGTACGCGACGATGGATGCCGAGGAGCTGACTCCTGAACTCGTTGCGACTTTCA
ACGAGTCGGCACACCACGCGGGTGGTAAATTCGTCGTTCTCATGATGATTGCAGCGGTGGGGTACGTCGGAGCTGATGTCGCTGCTGATGCTATGATGGT
GGAAGTAGCTCAACGTGAGCCAGAGGTTACACGGGGATACACACAGACCACGATCTACATGGTTCGAACTGCGTTTGTGATGGTCTCCAGTATCCTCACA
GGTTTCGCTTTCAATGGCAAGGACTATGGTGGAGACTTTGATTTCTCGTTAACTTTTCCGCAGCTCATGGTGGTTCTCAGTTTATACTGTTTCCCCGTGA
TCCCCATTTCGTGGTACTGCATCAAGGAAGACCCTCACCCGGGCGTGATTTTCCGCGACTACTTGGCTGAGCTTTGGCATCTCATCCAAATGCGCCCGAT
GTATCAAGTGATTGCGTACAAGTTTCTTGCTGGCATTTTCGAGAACTTCACCATTACCTGTGCAGACCCGATGCAGTCGTACTGGGCAGAAGTCACGCCA
CTGAACCAAAAAGTAATGGCGATCCTGGGCAATGGTGTATTCGCTATCACGCTCTATTTGACTGGCAAGTACGGTCTCCAATGGAACTGGCGAAAGATGC
ATGCTATCACCATTGTCTCGGTGACAATCATGGACTTCATTGTAACGATGCTCACGACGTGGAATGTCATACGCAACCAATGGTTCTGGTTGGGAGTGCC
CGTAGCTGAGGCTCTCCCGAATGGTATTGCTTTCGTGATCGCGACATTTGTGATGGTGGAACTCGCGGGCGAGGGCAACGAAGGCGCCGTGTATGGCCTC
GTGGGATCGATCTCCAACATTGCGATCCCCCTGGCCAGCACATTCTCCAAGAACGTGGGCAGCCATTTCGACGTGACCAACGCAGATATCGCTGAAGATT
CCCATCACGTGCGCTGGGAGGTGACGTACGTTCTCATCATCCGTTACTCCATGAACTTGGCCGGACTTCTTTTTCTCCCGCTACTGCCTCGCCAGAAAGC
GGAGACGCAGCAGCTCAAGTTTAATGGCGGATCTAGTCGTTTTATGGGAATCCTGACCGCATCCTACTTCGTATTTTCGCTGTGTTGGACCGTCATGGTG
AACATTATGTCCATTTATCCGTCTACCTCATGCCTAGCGATCGCTGGAGGCGCTGGATGTGACTCG