Description :
From Genome Similarity Track
Location :
contig_129:8776- 15662
Transcript NameFunction/comments
g14129.t1hypothetical protein

Sequence
6886 bases(100 bases per row)
GGAGGTGACTAAGGAGAAGCGCTTCAAGGAGCACAGGAGTAGTCTGAAGCTAGCTGCACTTAGCGAGGCAGAAGAGCAGCAGCTGCGGACGGAGTGGAAG
GATGAACCGGCACAGGGACTGCTGGAGAGATACCAAGGACTGGTGAGCTACTGGGCTGAAGACAGTGCGGAGCACAGGCAGAGGTTCAATTTTTTGATGA
AGGAATGGGTGCTGCAGAAGGCGTTAACGCAAGCGGAAATGGAGAGGCGGATCCAGTTCTTCCAGTTCGAAGAGACGCAAGAAGATAAGAAACTGCCAGT
AGGAATGGTAGTCGTATAAAGTTGCAGTGAGCAAAGGGATGGCAGTGGGCGGGAACTGGCAGCTGACGGTTGATCAAGAGCGGTTGAATGTCCTGTGCGT
GACTCCGTTTCCGAAAGTGACTAAACTGCGGCCAAGGACAGAAGACGAGGACATGGCACTTCTGATGCTACTCAATCATGAGATCGAAGTGCCGCACGTT
CCAAGCTTCTTAGGACAGTCAATGACGGCGCGTGAATTAGCGCTATTCTCGAACATATTTTTAGCGATTGAATATCCTGTGTACGCGCACTTGGCACCGG
GACAGAGATTTGGCGACAACCTGTCGAAACACGTGCTATTAGCGCAAATCCACTCAGGAGCGGAGGCGGCGATGCCTCAGCGGCAGGAAATCATGGAGTT
TAAGGCGACCATGTCGAGAATCTCTCTTGACATGAATTCGAGAGTGTTGAAAGTTACTTTCAAAGGGAGACACACAGCAAGCAAATGGATTGGATGGAAG
GTGCCATTTGCCGGGAAAATGCTGACACTGCTGGACTACGAAGCTCAGAGAGAAGAGGCGAAGTTGACGCATGAATTGATCAAACTTGATTATGACTCAT
TCTCAGTAGCGGTATGCAGAGGAGTAGTATCATCGAAGGAGCTATACTGGATCATCGCAAGCGGAGCTGGGTTGCAAGTGCAAACCATGAGGAATCTGGA
GGTCGGTCAACAAGGGATAGATGATCAGCAATGGAATGTCAAGATACGAGCAGTGGCGTGCCCAGAGAAACTAAAGGAGATTGCGTACTTGGCGGTTGAT
GGCGTTGAGATTGTTGTGCATCACCATGAGGTGCACGTCAACTGGCCTTGCAGGAATTGCTTTTCACCGGACCATCCGACCAAATTTCGCAGGACGAACC
AAGGAGAGGTGAAGATCAGGAGGGCTCATCACACATACAGTATCGAAGGACGGCTACCATCGAAGAAGGTATCACTAAACAAAGGATACGATGTGGGGAG
CCACCCGACTACTTTGGAACAGCTGAACGTGCTGTTAAGACCTGACATCACCAAGCAAAGCAAAAGGGCGGAGAAAGAAAAGAAGGCGGTGGAGCAGAAT
GCCAAGGACCCACCTTGTAATGTGGATGTGCCAAAAGAGGAGGGACCAGTGCTACCTGCGGAGTGGCAGCAGCACAAACCATTGCATGGCGAAGACAATA
GCAAATGGAGTGCCACAATAGGCGATGGAGGGAGCAGGGTCATAGCTGACAAGAAACTAAGCGAGGGGAGGGACACGGAGAGCCATGGCGGCGCAGAAGG
GGAGCATCGACGGTCTGGACCGCATACTGTGAAGGCAAGACTGAGGACATGGCTCCGGATATGGAGATGGGTGAGGGGACGGCCGAAGATAATGACTTGG
TTGAACCAGAGGAGGATTGCGTTGGGGAACATCTGAAAGAGGGCCCTACAGTGGACGAGCGACCCAGAGAAAGGTCGCCAACGCGGAAATGGGTGATCTC
ATCGCGACAACTAAGGTACAGCAAAGATGCCAACTCGACTGGAGTAGGCAGTTTAAGATGGAAAGCTAGCGACAAGATCAACCCACAATGAGGTCAAGAG
CAAGGGTACAGAGAACTCACCCAAACGCCGGTGGTCAAGCGCCTAGCTTCATTGTCGCCCAAGAGACGTGCGCCAGAGGAATGGGACAGTGAGCGACCGG
GGAGAAGCAAGGAGCAGAGAGGCAAATAGCTACAAAATGCTCCAAGACGATGGAAGACCAAGTCGTTATCTCCACGTAGAACGACAATGGCAGACAAAGG
GATCAAAGGGAGCCTGCGCCACCAGTTGTTTATGCACCAGTATCTGCATGAGGTGAGCGAAAGGAAGAAGACGGGCGAGGAGTTTAGTGCGATGAAGCCA
CAAACACACGCGGAATTTCACGAGGTAGCGGAACAGCACACAGAAGTGGGGAAGGCGGTGAAAGCGCGGTGCGGGGGCGACCTGAGCGAGGACGGCAGTG
ATGACGGAAACGATGACATCAAGGTCATCAAGGTGACACCAGTCACGGATGCAGAGGCACCACTGGAGGAGTGGTTGACGCTCATTGAAGGGCGGATAGT
GGATGTGGCAGCCCAGACCAGTGTGGTTGGTTAGCATTCTCTATGCAGCACTTACGAATTTCAGCGAAGGACTGTTGACACTCTGATGCAAAAATTGCGG
GGGAGGCCAACAATCTCAAGAAGCAAGTCATCAATGGCATGTTGGCCAACCTGGTGGATGAGAGTGGATTGCATCCAGTGGAATTGATGGTGGAATTGGA
CGTGATTGGAGCAAAGATCAAGGAGGTGGCCAACTGGGAAGAACAAATTTACGCGTTAGCCAACCACTATGCGAAGCAGCGACAAAAGTCGGTGAAGGTG
CTGGTTCCTCTGCACTATTGGGTGCGACCTGCGCACATCAAGGCGATGACAATGCACGCCAGAGAGACGTTGTATGTGTTGCATGTGGAGGCGAACGGCA
TGGCAAGGACTCAAGTCTATGCTTACCACAACGTGCGTATCTCAACAGACGACTACATTGAATCGGGTACAGTGGAGACAATGGACACCAGAGACGCGAT
GCAGCTTTTCAGGGCTCTGACCCAGGGCGGAATACTGCCAACGGTGCTAATTTTGCAATGGCTGAACACGGGTAATCATTTCCAAGCAGTAATTTATGAC
CAGGACAAGTACGCAGCTTACACAAAGCGGACGGACGGAATGGAGAAGACAAGGAACAAGATCTTAGCGAATAGTGGACGCGTCGAGCTGGACGCAGAAC
CATACGATCACTTGAAGACTACCAAAGCGGCAGTGCGTAAGCTCAAGGGCACCCGCAAAGCCGCCAGAGTGCTGTACAGCAGGACGGCCAGCATGGACAG
CAGAGTGGAAAGCAACTCGAGTAGCGAGGCGACGGAAGGCGACCGAGACAGTGAATGGGCCAGAGCTCAAGATTACGTCAGGGGAAGGGAGCGAGCGGCA
GTTGAAGACGCGCCCGGAGAAGTGGATACTCAAGCGGACAATGAAAGGAGGACGACAGCTGCCAGCCTGCTGCCACAAAACACGATGGCAGTGGAGAAGG
GGCAAGGGCGGAATGAGCTACCCGGCCATGCTGCCCAAGAACATGATGCCGCAAGTTATGGCGGGGGATCTCATCACAGAAGTTTCCTCACTGGGAGAGA
AGGGGAGAGCTGAGGGGCCTACAGGAGATGGAGCACTGGAGGTATGCCAGCACGGTGACAGCAGAGTGTCCAATGACCAGTAACACAGAGATTCACACAA
GGAGGAGGCTGTCATACTTTCACAGTCGACAATCTCTTCCTTCTATGGGAGAGTATCGAACGTGGAAACGAGCGAAATGAGGAAAATGGAGTTCAGACGA
TGCAAAGCGAAGGCAAAGATCTGAAGTCAGCAGAAACAAGAAATCAAACCACTGCTATCAACACAAAATGACAGAACACTGGGCTTAACCACCATCAATG
TTCGGGGTTTGGCCACACATATGGCACACCTAGGACGTAAACTGCATGGCACTAAGGAAAAACATGAGCGAGGACAGAGAGACATTGTCTTTCTACAGGA
GACGCACCTGCACGAGGAAGAGAATGGAGCAGCGCGGAATCAACACGCAGCCATGTGGGGCTTTAAACACAACAGAGCAAACAACTTCTCTTTCTGGTTG
TCAGGGGAGAATAGAAGAGCAGGGGTAGCGATTCTTATCAATCCGTATGGAGAGCTGCAGGAAGCAAAGCCATGGGGAACGGAACACTGGACGGAGCATC
TAATAATGATCTCAGGAGATTTAGCGGGGCAGAAGTGCATTTTTGTGAACATATATACGCCATCAGCGGGAGACGTGCGGGTCCAATTCCTACAGCAACT
ACAAACGATCGAATTTCCGGCCACAACAATGATAGTATGTGGAGGATATTTCAACTGTGTGGGGCAACGAGATGTGGATAGGATAGAGGGAGACAGTAGA
GACGATATTGGGGCAGCACAGGTGGTGGCCAAATGGCGCCTAGTGGACGCCAGATTCTACAATTTACCAGCGAAGAAAGGAGAGTAGGACATCAAACAAT
ACGCAATTGAGCATCACACTCACACCCACAAAGCGGTAAGTGAAGTTATAGGGTCCTCACGACTGGACAAATGATATGTAAGGGCTGAGATCAAGAGACT
GGTGAGGGGAGTGACAGCGGAAGAATTACCCTGCGGAGTAGACCACAGAGCCGTCTTGATGGAGTTGCATCAACCACAAGGAGCCATCAGGCTGAAGAAA
CGGTCGAAGATTTACCCTCCGCCGGCCTATGTGCAGATGACGATGACCAGCATGATTAGGAGGAGGTTAGAAGAGCACAGGATGGAGCAGGATCAAGTTG
CGGTGCTGGAGACAGGGGACAATTGGGACAATTTCAAGAGGGCGATCAAGACAGAGATGACAGAACTCAAGAAACAAGCGCGGAAGCGCATGAGTGACAG
CTTTAGACAACGCATCCGGAGGATCAAGAACAGGCTGGGGCGATGCGCCGGAGACGGAAAGGAAGGAACTGCTGGGGCAACTGCAGAAGGAGCAGGATGG
GAAGAGGACGCTGAGGCGAAGAGTTTTGATAGCCAGGAATGCCTGGACATCAAAATGTAACACACGGCACTTCTTCCAGAGAATATGCACTAAATACGGA
GACAACGTCATACCCACGCTGATCCCCAAGCAGGGTGTCACCCATCGCAAGCAACAGGTCAAAGCGGACATTTTAGCAGATTACTGGGAGCCGATTCTAA
GTGGGGCAGCAGTGGAACAGGTCTCTATCGAGGAATATGTGGACAACATTGTGAGCAACTGGGAGACGGAGGATCTCACGGACATTGATGAAGAAATTAC
CGAAGGAGAGATCGAGCGAGCGATACACAAAAGCAAAAGAGGCAAGGCCTGTGGGCCGGATGACCTGGGGACAAGGACAACAGTGAGTCGGTGGTGCCGA
TCTTAACGAGGATACTGAATGGCTGCATGGAAACCGGATTGACCCCGTCCACATCTGTGGAAGCCTTCATTTTCAGCATCAGCAAATGAGGAGACAAAAG
CAACCCATTGAACTATCGGCCCATATCGCTACTGAACTCGGACTACAAAATATTTACTAGGATCCTTGCGTGGCGAGTACGGCGGCACATCACGAAATTG
GTGCACAGGACACAACGCGGGTTCATTCCAGGTAGAACAAATTCGTGAAGCGATTGACATGCATGAAGCGGCCAATGCTGCATGTAGAGAGGGGCGAGAG
TTGACGGAGGCGCAGGTGCTGTTGCTCGACTTCGTGAAAGCCTACGATTCGCTTGATAGGGCGTTTTTGATGGAGGAAGGGGCTGCCACCTAGGTTTTGC
GCAATAGTGGCGGCAATTCACGCCAACACCACAGTCAGGTTTATGGCGAATGGGGAGTTTTCGAGGGCGGTCAAGGTGACAAAAGGCATACGGCAGGGTT
GCCCACTTGCTCCGCTGCTATTTATTCTGGCGGTTGACCTGCTCTACGATGAAATAAAAGAGTGACGGCAGACTCAGAGGTATTGCACTAGTCAGCGGTA
GTGACGCGAGGCCTTTGCAAGTGTTTGGGTACGCCGATGATACGGCCATTTACATTGCACATCGAGCTATGCAAGAAGCAGAAATACAGACCATAGCACG
TTTCTCGGCATGTTCGGTATTACAACTCAGTAGTGGTAGGAGACAGCACCTTAATTTTAAGGCTGATGGAGACGCGGAAAAAGCCGACATCGAAGAACCT
GATACACTGGCACAAGCGAACAAGGCGTCTCGCGGATGAGTAGCTGGCAGCACAACTATCGCGCACACAACAATATGGCGAATTGGTTGGCCAACCAGGC
CATGGATCGAGGAGCCAGCACGATGAACGCTCGAGAACCAAACGGTGAGATGTTGCCGCTACTGACAGGGGTGACGGAGAGAGCAGACAACGATGCCAAA
CAATGGACAGACAGAAGGAGAAGAGGTCGGAAGGTGGAGAACGGAGAAACGGAGAAGCGGAGATGCTAGAAGGAAGTTAGGAAGTGGGTGGTGGCGGAGG
AAGAGAAGCGCGCGACCACCCAGTACTGGATCAGGCACCAAGTCGATCTGGAGTGGTGATTAGCGTTCAAGACCCAGGTCTTGTAACACAATACACATCA
CCCGTTGAAAATAAAAGTGTTACTCAAGGTCAGCGAGTTTCGCAAATGAACCGCGAAGTGCACATTTGGGAAAGTGCTGTTGCCAAGTGATTTTATCACG
GTAACATGATCACAGTGGAGAAACAGGGTATCGATCCCTGTATCCCGTATTGCGACTTAGATCTTTAATTCGATGGTCCTTTATTCCTCTCGGCTCGATT
TTGGGTAAAGAAGCACTCGTTCCAGTCCGCTCAGCTACTCTCGGGTCTCTGGTATTGCGTACATAAAAGATGAGTACACCACCTACATATAAAGTTTAAG
ATACAACTTACCTTCGAGTCTCTTGAATTTCTTAGCAGCACTCTGACTGCGGGTGAGCGCTGACACGCTTGGTTGAGGTGCTTCGT