Description :
From Genome Similarity Track
Location :
Scaffold_67:87752- 88979
Transcript NameFunction/comments
Hyaar_Emoy2807667Zinc finger MYM-type protein 1
Hyaar_Emoy2807668hypothetical protein

Sequence
1227 bases(100 bases per row)
AGCTTGATGTTTACCTCTTCTGTTTGTAACCACGACTAGACTTGGCTACCAAGTCGGAGTGTCTGGAGCTGTTCCGCTTCTTGAAGAACAAGGATGAGCT
CTCGCGCTCTTGTAAGGAGATTATGCAGATGATCACGGCCAACGACAAGGGCGTCATGGAAAACGATCCACTAAACACACACGGCAGCAGAAGAACTCGC
GGCGGGATAAGCCACGCTGCGCTACAGCGCCGCTTCACGGGCAAGATGTCGGGCGGCAGTCTCTCGGGCTAAGCTGCTGTTGAAGGAAGGGAGCTGGGTC
GAGCCCAGTTTGCCTTGTTGCAGAGCGGGGAAACGCCGCAGGATGGTCGCTTTATAGGTACTGAACGCATTGCACGTATGCTTGTATCTTTTCAAGAATG
TTGCGTCGGTCACAAGCCGCCGCTGAACGATTAAAGTGATTTTTAAGCAGTAACTTGAGATTAAACCCGTCCCTTTACGTGAATGTAAATATACAAAAGT
AACCCTTCTGCTACCATGCACTTAATCACGTTCATGTGTATATTTTCTGATACAAATCACAATTTTTAGTGCTCACCTGAACGAGCAATTAGGTCTTTTC
CTTTACCAGTCAATTCAACCTACGCTCAACATGGAGCTGCTGATCCATCGCGTCGCGTCGGCGCGTCTACTAGCGCCTCGCCACGTCCTCGTTGCCACCT
ACCGCTCGAAGCGTAGTCAAGCGAAGCGTAGTCAAGCGAAGCGTGAAGCTGTTCGTGGCAAAAGCCGGGAGGGTCCTCTTTCCAATGAGAAAAAGAAGTC
TCACAAAGATCAGCGTCGAGTGCATCGCAAGAACGATGATTGTGTCGCTAAACTGCCTATGGAGAAGCCACCACGCCCGACGCTGCAAGAGATTGACCAA
GAATGGGCAAAGATGCGTGTACGCACGGTGACCGTTCCGCCTGCGGTGATGCCGGCTCGAACACGCAAAGAGGTTGAGAACAAGCGACGTATGCGGCGTC
TAGGGCTGCTGCCAGATGATCACGAAGAAGAAGAAGAGGGTGATGAAGCTGGTGGTTTTGATCCACGGAATGTGGGATTCGTGGGTCGTCGACAGCCGTA
CGAGTATGAAGCGACCAAGTCAAATGGCCGCAGTAGTCGAGCTTCTAAAGCTGAGAAGGAAGCCGATGCAGAAAGACATCGACTGACGGGACGTCTTCCA
GCGAGACGACCCGTGTCGGCAAAGGAC