Description :
From Genome Similarity Track
Location :
Scaffold_51:87743- 93833
Transcript NameFunction/comments
Physo_137123reverse transcriptase

Sequence
6090 bases(100 bases per row)
GTAGCACTTTGTAGTCCGTCCAACGAACGTTGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCCA
CTTCGCCTGCAACTCATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCGGC
AGTAGCTGCGATGCTGCGTACGCAATCACCGACAGAGCAACATGGTGTTGCTCTGGGGTTCATCATGAAGGAGCAGCGTGATGCTACTTCCTCTACCACG
GTGGCGTCGGAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAAC
TCGACACTGCCATCGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGCCTTGGTGGACGAGCGAGAAGTTGGGCGTATGG
GCGCTGACTCTCTGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAGG
GCAGAGTTCCTCGACCTACAGCAGGGTAAGCATGATGTTCATGCTTACGCGCAGAGAGCACGGTATTTGGTCTCGAACATTGTGACCAATCCAATAGACG
AGGCGACCAAGGTCGTCACGTTCATGAAAGGACTTAGAGATGGGCCTGTGAAGATCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTAC
TCTTGCAATGCATGAGGAGTTTAGCCTGCGACAGGCTAAGCTGCATGCGAATGCGCCGAGGCTGCGACCACCTCCGGTTGCGATAGCGGGAGGTCCGGAA
CCAATGGACCTCTCGAATGCAACGGCTGCTGATTATCAACAGCAACAAGGAAGTACTGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAG
AGTGCACGGCACCCGTGCACCGAGATGGTGCTCGACGCGGCGATGCCGGGCATCGCCACGGACAAACAAACAACGCTGGAACCCAGTAGGCGCGGGGCGC
CCAACTGGTGAAGCAGTCACGCGTGTCCAACTCGGACATGCGACACTGAGGACTGCAGTGAGGACCCTTCTCACTGCAAAATGCATGATGACAAACCGAA
CCTTGTCATCTTGGACGTAGAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTG
ACTTCGAGGAGGTAATTATACCTCGAAGTATGTTGGAAGTTCGATTGGCAACGGGTGCCATCGTTAAAACCGAGAAGCGCATGGTACGCGTGCGCTTCAC
GTATAAAGATCAAGTTTGTCGAGACGTTTATCGTCCTGGATCTGGACGATAAGATTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGT
CATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGAGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGC
GACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCAGCAAGCGTCGGCGTCGCCGCCGACGGCTGAA
GGAGAAAATGTGTTGATCTCGGAGACCGACACCCGCTTTTCAGCGAATCAGGAAGAATCTCCGAGCTCAAGGGGGCACGGATGACGCAGGCGAGTCACAC
GCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGACGCAGCGCCGTCGACTCCGGGAGTCGATGGAT
TGGGTAAATTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTTCG
GGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCTGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCG
ACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGTACCCGCCGGCGGTATACAAGAAGAACAACCGTCCACGGCTGGGCCTGTACGAGGTCAGGAGTC
ATGCGGAGCCGGGCTCCGCAGGACAAGAAGACGGCGCATGCGAAGGTCGTTGCGCAAGTCTCGGCTTGGGGCCGAGACGCTACAAGAAATGTCTCCCGGG
CGGACGGAGGCAGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTACCAGGTTCCGGTACAGAGAGATGACTCTCGCTAACCCTCCGA
CGCAAGCGTCGGTGTTGACTTCACTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGCGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGA
CGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAAACTAAGAAGAAG
CGCTTTGAGGAGCAGAGCTGGGACTCGCAGAAGACGAGTCCCTTCTACGAGATTCTACGGGGGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGC
TTCCGCAGGACAAGGGCATCCAGCACGAGATTGACCTCGAGCCGGGGACGAAGTACTGTGTCCCGCGGCAGTGGCCACTGCCGCGAGAACAGGTCAAGGC
GATCGACGACTTCTTCGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGC
GGCTGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCAGCGCAGACACCGATACCGCAAAAAGATGTCATCATCGATTGGATGGCCA
GGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGCTCTATCAGATCATCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGG
CATGCTCTGGGAGTGGCTGGTGATGCCGCAAGGGCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGTGCTCGGTGCGCGACTTC
GCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGC
ATGAGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCG
CCCTGACCCTGGGAAGGTCAGAGTGATCAGTGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGTAAG
TACGTAAAGGACTACGCGGGCATGATACGCCCGCTGTCCCAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATG
CAGTCAAGCGGGGCTTGACCGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGGTCGACGCATCCGACTTCGGAATCGGATG
TGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAG
GAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCACTGCGGACGG
CAGTGAAGTCGTCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCGGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGT
GGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGATCCCCCGACGTCGTCACTGT
TGGACGACGTGAAGATCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGACTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAA
GCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTACTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGAC
CATGACCTGCAACTCAGTATCATGTACGAGTATCACGATGCCCCGACTGCGGGGCATCCGGGCTGTGAGAAGACATACCTTCTTCTGACGCGAGACTTCT
ACTGGGCCCACCAGTATAAATGGGTGCGCAAGAACGTCCGCGCTTGGGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGATCCCTTGCAGTC
ACTGCCGACTCCGTCGGAGTGTTGACAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCATTGTGGTCTTTGCT
GACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAATGACTGCGAAGCAGACGGCGCATCTGTTCGTTGACATGGTGTTCAAACATCATG
GCATGCCGATCGACATAGTGTCGGATCGAGACCCGCGCTTCACTGCGCATCTCTGGGAAGAAGCTCGATGTCGACTGCGGACCATCCGCATACGGACGGG
CAGACCGAGCGCGTGAACCGCGTGCTCGTTGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCTGATGGCGGAGTTCGCCA
TCAACAACTCGGTGCGTGCCTTGACTGGACATACACCGTTCTACGTGAATGCCATGAGGATATACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCC
TTAAGTGGGGGAGGATCTCCGACTGCAACGCGGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGACACGAAGTAAAGCCGAGAACC
GCGCGTCTGTGCAGGGCACAGACGCCGGCAAGCGCACGAAGAACGTGTCTGTGCGAGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGC
TGGAAACGAGCTGAACTCGTTCAGCTCGGACGCAATCACTTATTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTG
ATCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACA
TGCCGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGGCACGGCACGGCAACGCCTACACACTGGACATACCG
TCTAGTATGCGCCTCCATCCGACGTTCTACGTCGGACGGCTGAAGCCATACCTGCAGTACGAGCTACCTAACTCGGCTGAACCGAAGTAGAAGACTCGGC
GGAAGCCGTCATCCTCACCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGAGCCAATGGTCCAGCTCGGCCGGAACGATCGAGGCGGCCTGGGAGGCCGCC
GCAACCTGAGGATACTCCAGAGCGCCGAACCCAGCGCTCTGGAACTACTCCACGACCGGAACTCGGTCGTGGGGAGACGCGAGATCAGAGTCAACACCAA
GTTGACCACACACGAGGCGTGTTTCCACCACCACCGCCGCCAATTCGTGACGCACACGGCTCAACTCGATGGATAGTTGAGCGGATTGTTGGTCACAGTA
TCCCGAGAACGAACAGGCAACCGGTTCGTTTTCGTATTCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGGGAGTCGCGGAACGTCTTGCTCGAAGA
CGTCCCGGACATGGTGAGGGCGTACGAAGCCCACCATGCACTACACACTGGAAAGTAATACGAGCGCTGTTGTTAACAACAGCGCCCGAA