Description :
From Genome Similarity Track
Location :
Scaffold_207:87733- 93669
Sequence
5936 bases(100 bases per row)
GCCCAGACCTTAACCGAAGAGGAAAGGCTCCGGACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCTACGAGTGCCTCGGATGTCGGAGCGCCG
ACCTTCCCAGACGTGGGTAGCAAAGCACCGCGTCACAGTCGCCGCCGACGACGACGTCGCTTCAAGTGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACA
AGGCCGGTGGAAGAGTGCTATCACATCTTCGATGGTGAGACCGGTCTACCCGTCAAGGCATCTGGTGTCCACTTAACCCGTGGCCAGAGGTTGCAGAGAT
ACTGAACCTCGAGGAGATGACGGTCGAGGCCTTCCTGGCCAACCTCAAGGCTGGAAATGTTGCCGAGATGGTGCTCATTAGACCTAAGACCACTCGGGAG
AAGCTGAACGCCTCCTCTGTCTTAAACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACGAGCTTGGGTTCTGAGATCCTTAAGAACCCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGATCGAGGCGTACGGCATGGGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATGGCCTTTCCCTCGCGAACAGTGCGA
GGTCATTGATGCATTCTTCGCCGCGAAAGCGAAGGCAGGCATAGTGCGGGAGTCGAAATCCCCGCACTCGATGCCAACTTTCAACGCTCGGAAGCTGAAC
GGAAAGTGGCATCTAGCTCACGCTTATAACAAGCTGAACAGCGCAGCGGTGCCGGCTCAAATACCAATCCCACGTAAGATTATGTTGTTAAACAACATGG
CCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAGATTCTGATGCGAGAAAGTGACATCCCGCTCACTGCTGTGAGCACTCCAAG
CGGCATGATTTGGGAGTGCCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGCTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTACTTAGGGAGGAAATACGGCCATGGAGGTGCATTTAGGACACCTTCGTCGAGTGTTAA
ATATAATGCGAGCAAACCAGCTTTACGCCAACATCGACAAGTGCGTTTTCGCATCACCAGAGATTAAAGTTCTCGGCTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACCCCTCGATCCAAGAATAATCTTTTAAAGTGGTTGGGCTTGGCCAACTACCTTCAT
AAGTGCAGTGCGGGGTACGTGGGCTTTGCTAAGCCCTTGTTGGGCCTCCTTCAGAAGGACGTCGACTGGCACTGGGAGCAATAGCACCAGGATGCCTTTG
ACACCATCAAGCCCATTCTCCAAGAGGCCCCTGTCCTGGCGGATGAGACGAAGCCGTTTAGCGTCGTCTACGAGGCCTTCGACTACGTCATCGGGAGTGC
ATTGATGCAGGCCGACACGGCTGGGCATGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGATCGCGACAAGGAG
CTCCTGGTAATGCAATATGCTCTTGTAAAGTTTTGTGTTCCACTTCTGGGCTCCCGTGGTCTACATAGACCACGTGTCCTTGACTAACCCGCCTCAACGC
TCCCAAAGGATAGCGCGGTGGCTGTCCTTCTTCGAGAAGTACAACTTCCTCGTCGAATACAAGCCGTGCAAGCTCAACGTGCTTGCGGACGCGGCGTCCT
GACTACGAGTTAGCCCACATCACACGGGTGACAACGGATCTATATGGACGGATATGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGT
TCCTCACGCCAGGAACGAGCGTGAAGTCCGACTGGCTCTCGTCGTGACAGCGCTCACGGCTCCACCGATATGAGTTAAAGGATGGCTTCCTCTATTACCG
GTTGGAGCCTAATGAACATCCAGGGGTGGTCGTACCCAACGCCGAGGATCTGAAGTTTGATATCCTCGCGGAGGCGGACGATTCGCCCTCCAGCAGCCAC
TTGGGCCGCGAGAAGACCTTTATGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTGAAGACGCGTAGATCATGTC
AGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTATTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCT
TCCTGCCGACGGACACAGCAACACCGGAATCCTGGTGTTCGTTTGTCGGCTGAGAAGATGGTACATCTTGCACCGATTCCCGTTACTGTTACGGGCGAAC
AAATCGCACGGTTGCTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGGCTCCGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAA
AACGCTGTTTCCTTTACTGGGAACTCGTCGGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCAAGTTCTCGCGGAC
ACCCTGCACAGTGTGTGCCCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGGGCCCAACAACGCAGTGCACGCGTCCACGGGGT
TCACGCCGCTCTACTTGAACGGCTCCCGTCGCCTCAGAGTGCCTCTCACTCTTCGAGGTGACACTGACGCCTCTATTCTAAGTGGGGGAGAGGCTCGGAA
AGCCCTTGCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGTGGAAACAAGTGGAATCCTTTAAGGATACCAAGCTGAGCATTGTCGGCAGGGTCCGC
GATGCCATGGCAGCGGATCAGGATGGACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTAAGATGGGGGACTTAGTGTTACTAG
ACACGAGGAGCCTACCTCTTGACCATGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCTGTCCTGCCCAGACGTGGTGC
GTCGTACACCATCAACCTGTTAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGATACTTTGATCCACAGCGTGTTGCTGGCTTG
CAGACCCACCTTGGCCCGGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGTGGGCGCCCAAGCCTAGGTCTGGACGGCAAAGCT
GCGGTAAAGCCCGTACGCAGGAGGGGCTCCGTACGAACGGACCCCGGATCCATACGCCAAGTAAGCTGGGTACGCCGGGTACGCACCATACGCGTACGTC
TGGGAGTGCGTCGAAGGCGGCTCCGGGCGTGGCAGCAGAGCCTCGATCTGTCGGATCATGCAGAAGGCCTCGTCCAGATTGGAAGAAGAGGCCCAGCGAT
CCACCCGCAGATGCAGGCTCGCGACCTCACTCTCCAACAGGTCCAGCGGACTCGCATGACGAGCGAGCTAGCCCTGATTCCCGGCCTGGGCGGCTGCATC
ACCGCCAGTCCCAAGGCCAAGTGCGATCTCAAGCACTAGAACTCGTTGACGGAGGCGGTCATCCTCAGGGCCCTGTGTCGGACCCACAGGAGAAGGACTC
GGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACCCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATAAAGAAGTCCACTTTCACGTGGAG
CGGGTCCTCCCGGAGCGACAGTGTCGCGGTAAGCGACAGCTCCTCATGCAGTGGAGGGGTTATGCCCACTCCGAGAAATCGTGGGAGCCGATCGAACGGC
TCCTGATTGACTGCCCGAAGTATGTCGCAATCTGGGGACAGAGGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTT
AAAGACACTCCGTACCCGCGCTTATCATGAGCGCTAAAAGGCGCGCGCTTCAGGATGCCCCTTGGCAGCATGCGCTTGCTCAACATGTGGTCAAACCGAG
CACGAAGATCACGCTGGACCAGGATGCGGGACAGCAGCTGATCTTCATGGATTTCCCGTAACTTCGTGAGTGAGTACTTGAGAGACTCCACCCAAGCCCA
GAACATGTCCTCACAAGAAGGTGGAACAGCTCTCGGGCAGAACATAGGGCTATCCCCAAAAAGGATAGAGACCACCCCGGTTCTCAAACTTCTTGCGACA
AGGAACAGCTGTTCGTTGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTTGCGGCACATCGAGCAGCCTCCAAGTTGTTAACGAACAACTGCTCCTTCCG
AACGAGGGTACGTTCGTAAATGCCCCTAGAAGTGTGGCCACCCACGAGGAGCGACGAGAAGCTCTAGGAAGATGTCAGCCGCAGTGCTCTCCTCGAGAGG
CCAATACCCTTTCGAGTTGATGGCAGCTCCCTGGCAGACGGGTGCCACCACCGAACCCGCACAAGCTGGGCCGATTGGAAGGCCTCCTGCCGCTAATCGA
AGTCATTTGTGATCTCCCGGGGCTTACCGATAGCACCCTCCTCCTCCTCTTCATTCTCCTTCTCGTCCTCTTCATCCGAGGAGTCGAAAAGGCCCCGAGG
GGAGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCCGTACACTTCTTAGAAGGCTTGGTGTCTTCGGCTTTAGAGGTCTTAGCATGCGCA
AGACCCTCGGGACGCCAGAGGCGTTTGCGAGATTTCTCTTCCTCATCATCACCAACTTTTGGAGTGCCCTTAGCCGTGACGGCCGGACTCTTAGAGCGCA
CAGACGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCGCTGGACACTGGGCTGTGCCCTCCTGAAGAGCT
CGCAGGATTATTGTGCGGGCTTTTGGACTCGGCTTCGTCCTCACTGCCAGAGTCGAGCTCACGTTCAACGAACCGAGGGTTCGGACGATTGTCTGGAGAG
GCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTCGCTTGCTCACAGGCGCTTCACCCGAGGAACCAATCGCCTCGGAGGCCACCTGAGTAGCCGCTTAAA
GTGTCGAACCTTTGCCGCGAGGCTTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCGTCGCAACGCCCTTCGCAGTGTCACGGGG
CATAGTAACGGTCGAAGTGGAGACCAAGAAAAGGAGCGCACAGACTGCTGCTCGAGGCTTTAGCTGTGAAGTGAGCCCCTGCCGCGCTTGCGCGGCCAAG
TCGATGGTTTTCGACTTTGAGAATGAAAGTTTGTGACGAACACTTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAGCGGGGT
ACGTAGCTCTAAGTATACCCCTGGTTAGATGAACTGTGACACGTCACACCTCAGAAGTATGACACGTCATACTTCGGGATATTTGGTACAAGGTGCCAAA
GTCGTCCAAAGCCAACCATTGGTTGATGACATTACATTTCTATAGATGACTTGTAGTTTGTACTAAACCCAAGCTTTATCTACCAATAAAATATACTCAC
TTTACATTCTACCTTAAATAGGTCACTTCGCTCCCTTTTGATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGCGTTTGTATACTCTCGGAAGCTAAC
TTCATCTAGCGCAAGGTGCTGTGTGACCATGTCACA