Description :
From Genome Similarity Track
Location :
Scaffold_591:8773- 11043
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_591-snap-gene-0.7CofD

Sequence
2270 bases(100 bases per row)
AGTGGTCAGATTGGCGAGATCCACTTGCCAGGATATCCGTCCCATGGCTACACCAACGGGCACCACCGCGAATGGCGCAGCGCCCACGCCGCCAACGCCA
TACGCAGCAGATGCACAGCNNNNNNNNNNNNNNNNNNNNNNNAGTACGTCCACTGCAGCCGTCTGCTGCCCCGTCTGCAGCTGCGGTGGCGCGCTCGCGG
CGCTGTCGGCTGCCCAGCGGCGAGCGCGTGGACGAAGATCCGCGACGCCTCGATGCTGTCGTCATGATCCTCGAGGACGTGCTCTACGACCACACCAACA
TGCTTGCGCACTTTGCGATCGAGCGCGCCATCCAGCAGCTCATCAAAGAGCGTGCGTTCTCCAATACGTTCGCGGCCTATGAGGCGCTGCAGGCGTTCCG
CCATTCTTTCGGATACCGCAAGCGGTTCCCTCGCTTCGTGGACAGTCTCATCGCCCAGGAACGGCTCAGCTTTGCGTCGGCGCAGCACGTGATCCGCGCC
TACTACGAGAGCCAAATCGCCGAGGCGCGCACGATCCGGCCGTTTGACAAGGCCCGCGAGACGNNNNNNNNNNNNNNNNNNNNTCCACGGATACCAGCTC
GGGCTCGTGTGCGTCGGCAAGGACGATGTGCAACTCGAGCGGCTACGTACGCTCGGGCTCGACGATCTCTTTGGCGAGATTGTGTTTGTCGCGAGCAACC
CAAGCGTGCTGCAGTTGACGCAGGCCATGAAAGAGATGAGTCGTCGGCTGATGCTGCAGCCGTCGTCGATGCTCTTTGTCGGTCGCAAAGTGTTTTACGA
GATCAAGGCCGCGAATAAAGTCGGTCTCGTGACGGTGCGCATGGTGCGTCAGTCTCTCCAGCTCATGTCCTTCTTCAGTAGTATGGAAATGAAAATAACA
CTCGCGAATGTTGGATTGTGTGGTTATTGGGTGGTGTAGCTCCACGGCAAGTACTCGACAGTGATGCCCATTGAAGAAATGGAGCAGCCCGACTTCCAGG
TGCGTCGTCAAGAGAGACAGGGACATACTGGCAAGTGTATTGACTGACGTCTTGTGTCTAGATCGGCTCGATTGATCAGTTGCCGGCAGTCGTGCGGCTC
GCCGACCAGCAGCTTATTCGTCCCAAGATCGTCGCGCTCGGTGGAGGCACGGGACTCGCCGTGCTGCTCAAAGAGCTGCGCCACTACCCAGCAGACCTCA
CTGCGATCGTCACGGTCTTTGACTCGGGTCGCCACTCTGGTGCACTGCGCAAGTACCTGGGCATTCTGCCGCCTGGAGACATCCGCAATTGCTTGGTTGC
CTTGTCCGACTCGGGTGCGTGAGGGAATGGGGAATGAACTCTATATAGACTCGTAACGCAACAGTACTGACAAGATGACTGAAACTCTACTCTAGACGAG
GTCATGAACAAGCTCATGAACTACCGGTTCAAAGAAAACTTCATGGAAGGCTGTAGTCTTGGAAACCTGCTTCTCGCGGCGCTCACCGACATCCAAGGCG
GCTTTGACAAGGCCGTCACGTCCGTCTCCGATATTCTCAACATTCACGGCAACGTACTGCCGGCGACGCTCGACAGTACCGAACTATGCGCCGAGCTCGA
GGACGGCTCCGTCGTGGTCTCGGAAGTCAACGTACGAAGTCCGACCATAGTCGATACCGACNNNNNNNNNNACCGACGGTCAGGAGAGACGCAAGTCACC
CATCAAGCGCGTGTTTCTCGAAAAAGACAACGTCCAGGCCTTCTTGCCGGCCGTCCGGGCCATCGAGAATGCCGATATCATCGTGATCAGTCCCGGCGGC
TTTTACACGTCCATAATCTCGACGCTGCTCGTCCCCGGCATTCGGGACGCGATCAAACGAAGCGTCGGTGCCACCGTGTACATCAGTAATGTCGCGACGC
AGTGCGGCCAGACAGACGGCATGACGCTTCCAGACACGCTCGCAGTCTTGAAGCAGTATGTGGGTGAAAATTCGATCGATTATATCATTGCGAACAACGC
GACACCGTCGCCAGAGGTGATGGAGTCGTACTTGTCGCGAGGTGAGACGCTGCTGGTGCCGACCGACGAGATGCTGGCGCGGCAGCAGCCCATTATTCTC
CAGGGCAAGACCTTTGAAGACATAGACGACACTCTCCAAAAAGAGTGGGACAAGATGCCCATGATCAAGCACTGCGGAAAGACAGTCGCCGGGATGCTCT
ACCGCATCATCGAGCAAGAGATTGAGCGCATGCGCGACACAATGCGGCAAGGCGGCCACTTTCGCCACCA