Description :
From Genome Similarity Track
Location :
Scaffold_8:877160- 881068
Transcript NameFunction/comments
Hyaar_Emoy2801741protein kinase, putative
Hyaar_Emoy2801742protein kinase, putative
Hyaar_Emoy2801743insulindegradinglike enzyme putative
Hyaar_Emoy2801744insulindegradinglike enzyme putative

Sequence
3908 bases(100 bases per row)
GTTCCTCCTCATTGCACACGGACGTGGCCATCATAGAACGAGTCAACACCTCCTCTTCCGTGTCTTCCACTTCTTCTGCTTCACCCGAAAGGATCATATC
ACGCTGTCGAACAGCTTCCGTCTGCACAGCTGCGTCTAAATGATTTACCATAAAACGATAGTACTTCCACGTGCTATTGGTGAATCGCCGATCTCCTGAC
ACGTGCATCATGATCCCATTACGAATAAGCGCTGTACCAAGTAACAAAGCTTCTTCAGCAGTCGAGCACGTCACGCCTCCACGCATGGGACGGTTCAGTC
CATGACACAGCATCCACTCCAATGCCTCTTTGCCCGTGATCACATTCGGATGTGGTTTCAAGTACAAACTACGATCCCGTGCATGCAACTCCTGCCTCAT
CTGCTCCGCACACGTCCACAGCTGCCACAAACTCGGCTCGCGCACAATGCGACTCGAAATCCGTACTTTGCCCTGCACGCGCTTCATTTTACCACCGGGA
CGCAATTGCAAGTCGTACCACGCCACCCGCTCTTCACCACTGGTGTTCATGTCTTCTAAACTCAGCAACAATCGTCCCAAATCCTCGCTCTCGACGCGTC
CCTTGTCTTTGCACTTTACCAGCACGTACTTGGCGTTCACCAGATTCGTCTGGATCCCAAAAGTGTACTCTTCCGACGCCGCTGCTGCCCCAATTCCCAG
TGGCTGATGGGACTCGACGTTGCTCTCTAAGGACCGCAGGACCGCAGCTTTTAGCGGACTCCACACGGGATTCGCTTGTCGCATAGCAGGCGTGCGCTGC
TTCTCGCCCTTGATCTCCCGCTTGTGTTCGTCCAGCAGCACGAGCGTACAGTAGGAATTCCGACCTCGAATGGACTCGGTGGGCAGCAGGTCCCACGCTT
CAATTGGCGTCACTTTAAGTAAATAGCGCCGTTTGGCCTTGATACGCGTTTTGCTGGACGACATTTGGGTTTGACTTGGAGTACCTATGAATAGAAATAG
AAATGGAGATAGAGACGGATAGAGAAAGAGTGGAGGTACGGAATTAGACACTTGAAGTGTAGCAGCGATAGGTACATGAAGTGGAAGTGGGGTGGGACCT
ACGTGACGAAGGCTTTCGACTTGACATAGAGAGCGGAAGTGCCTTTGTCGCTGTACAGGAGGAGGGAGGAGGAAGAGGGGGCTACAGGACTTGGGGACGA
AGCGGTCGTGCAATTGTGGGTCCAGCACGCTTTCGCAGTGATGTTTTAGTGCCAGCAGCGAACACCTGGTCTTTTTTTTCGGGAACCGCGTAAATTGTAC
GACTGGGATCGGACAATTGGTCGATGATGGTGTGAAATACGATTTTTCTGCGATCAAAAGTTGAATACAATGTTTAGTGAAAGGTTTCGAAGGGATGATG
ATAGTGGTAGTAAGGATGAGACATACGTCGGACGTACAGTGCGAAAGGTTTGGAGATTTTCAACATGCTTTGGCTTGTGGACGCACGATTGTTTAGCTCA
TGTACGATCGTTTTCGTACAGTTAGTCACTTAGAAGAGTCAGGCAGAAAGCTGTGCGACGTGGTTAGGGCGATGCAATTAGGACCGCTTTGTTGTGGCAC
CAGAACCTATTTTTGCCGGTTTTACTATTTCCGACTGTATTTTAGAGCTTGATTTATCAACGTGTGTGTATTTTTGTGTGCGAGAGGTCAATTAGAGAAA
CACAGACATCCGTTTACCGGCCATATTACTCAAAAATTAGGATCAAATGGTCGATTGCGCACGTGTTTTGTATCGAAGCGCGCGTCTCGACACTAAAGTA
GACGTCTCACACATGTATACCGAAGGACGGTTGGGCGTTGTATACATAATGACGATACAGAGAAATGGAAACGTACTGCCGATTTGACTCACGTTTCAGA
TCATCTGTCGCCAGAACTCTAACAGCACCTCATGTACGATAGGGGAGCAAGCTCTGGAGCTTGCCCTTTGATACAAGTAATTTAGTTCGGATAATCGAAT
CAAGTTGCAAATTGCTATACAACAGCAGTCACTGAAGAATTAGTGTGATGCTGTTAATGTATGTATTAAACCATTACAGTATGCAAGAGCAACGCGATCA
GCCTTTGCTTATGAACGTCCAGCATTTGCTTGCATGATCATTTTCACCTTTGATTGATTTTAAGCCATTCACAAGCGTGCGCCACAATAGTGACCTAGGC
AAAGAGTGACTTTGAGTATACCTATATACCTATGAGGGGGTACTGGCTAGATCGCACTAGTACGTGTAAGGTACACCTAACCGCGTTATTTACAGACACA
CAGACAGATAAGTACGATTTAAAAGTTCGGCATTCAACCTTGCGCGCACTCACTAATAGCTTCACCCTTAGGGCTCGCAATAATACTGAGCGGTGTGTTG
ATTGAGATGCCAATAACGGCACTTATACAAACGGCAAAAATAGAATTGTTGTCCTCGTGTAAGTCGGTCAGTACGTCTGTCCTGTACATCAATCGAGACA
AGACAGCAGGAAAAGCAATGAAAGAGCTGTTACCGCGCGTAGACGCGACGCCGCTTCATCCCTTCGATCTTCATGTCGATCCGGCAGTTAAAATTTGGTC
ATCATTCTCACTAACAGTCGCACGAAAGATGCTTTCAGTACCGATGCTCTGCTTCCTGTTGCACCGATGGTAGTACAAAAGTCATGTGTAGATAAAAAAG
AACGGCAGGATCGTGACTGAGAGCCTTTGCAAGCTCCTCATGCTCGCTCATAAGTAGCGTAACTTTGACAATAGACCCACAATCTCGTTTACATCGGAGA
ATCAGATCGTTCGATCCTTTTCACGCGTCACATAATTAAGCACATTGCGCGCTTTGCGCCAAATGGCATCTTGCGTTACCGGAATGAAGCAAGTGAATGA
CAGCTCATCAAGTCAGTCTTGCTTGATGCCCTTCCTGGTGGCACAGTTGCTTACATCGAGCTGCTATCCGGTCAAAAAGTGTATGTGTTCGTGGCCCAGC
GATACCATTGATGATTAATGGTAAGAACACGGCCCGCGCTGTAGTAGCGCTTTGGCTTGCAGCAACATTATGTCAAGATGTGACTAGATGCCTCACAAAA
TCCTAACCACGAAAACTTGGAAGCAGTTCTCCAAGCCATTATTCTGCACGGATCTATTGATCGTGCCCACTATACGATGTACCTAGCGACCTGGAGGAAT
TTCCTTGCAAATACTCCTCGCGTTTGTAAACATTTTTCCACTCGTACACAGGGCTAGTGTCGCTTCTGGCGCCGTCTGAGTTACATCGCAAATCACCTTC
AGCTGCCAATACCCTTCTCAGTACCGTGGTTTCTGATGCTCGCTCTACTCATATTTCTCTTCGTAGATTATGGACGTTCAGTTCCTCCGTTCGTAAGCAA
AGATGTATGGAAACGGCTTTGTTAACCATAAGCAGGTCGTCATCAATATGGTTATCCAAATGTTGATAAACACCAATAATGTGCATCGTTTAAGCAGAAT
ACATTGTTAGTCAATTCTGCTCCATTACTGCAGAAGTTTCGGTCCTATCAAAACGAAGGTGGGGCAAGACATCCCCTTTGTTCGCACACGTAAAGTTTGC
AGCGTATCCGGGCGTAAGATTTAGGCTCTCATCTCATCCGTCGCTATTGCATCGAGATGATTGACCTGCCAAAGTCCCCGATAGAACCCAGTCTATTATG
GTCATTCTGCTTGACGTGGGTCAACTTGCTCAAACTTCAAAAGTATATAAGAGCCAAAAAGCCTAGAGTCTGGCTGCGATAGAGTCACTGGCGGCACGCT
CTGGGAATAGTGGCATCTGTCGTTTGAAGGTGACGATGTCACCGATCAACTTGAGTTGGTTCCACCCGTCGGAACGGCCTGGAGCGCAAACGTCTAGCTG
CTGCTGGA