Description :
From Genome Similarity Track
Location :
Scaffold_556:8770- 9774
Transcript NameFunction/comments
Phyta_totarag9241hypothetical protein PHYSODRAFT_552881

Sequence
1004 bases(100 bases per row)
GAGCTCAATCACCACCAACGAACAAAAGATCTGCAACGTTTGGGAAACGTCATGGCGCGAACGCAAAAGTCAAAACTTCATTTTAGTTTTGCCTTCGGAA
TGGCAAGAAAGATTTTGGAGCTCAAGAAAACGTTATTCTGTGTAGACAACGTTCATCGCAAACACGGCTTTAATTTTGCATAATTTTTGCTAACATTTAA
AAATTATTTGTTTAAAAATGGAGGGTACAAAACTAAAATAGAATAACATACAAACAAACAAAGAAATTCCTGAACGCAGGTTAATTTACTTTAGTTTTTG
TTAGCAGAGGGTGCGTAAGAACTGGATATATAAGGGTGGCAACCCAAAACTCATCAAGTTCGGAATTACTCCGATTGGAATCAAACACGGTCCCTAACAC
ATCAAGGTTGATTACCTTCCTTGGTCCACGTCGCCTCTGTTGTGTTCATGCAGCCTTGTCGGTCGTGTGTTTGCCAATTGCGGTGTGTGGAAGTGTCGCA
CATCCTCCCTTGCAGCAGGGCGGCCAACCACTTTGCTGTTAATAAGGAGTACGGACCTTATCTAGGCGAGGCGTCGACGTATGCGAAGTAGGAACTTGTA
ACCAACAAGAAAAATAAAAGAACTCTTGTTCTCATTAGTGGTTGTTTATGCAGGGAAAATCTACGACTGACTCCAAATATACTGGTGCCGGTAGCACGCC
GACCCTACCTGGTAGGTATGACACCTCTCCTCCTTGGAACGCAGAGGGAgcgtcctccgtctccgGCGTGCGGCCACGCCGGTATACCTCTCAGCACCAT
TGTCTGTCCTCATCCTCACTTCACCATGTCGCCTCGCCTCCTGCGTAGCCTGTCATCAACCCAAGACGGCGTGTCCTCCCGCCGGGAATGCGCTCCTAAC
ATCTCGCGTCATCAAATGAGCCCCTCCTCGGAGAGATGGCCAGAAAGAAAGATGAGTGTTTATGTGGCCCACGCTAGACGTTGCCATTCCATGATCTTGC
CGGG