Description :
From Genome Similarity Track
Location :
Scaffold_1303:877- 3577
Sequence
2700 bases(100 bases per row)
TACCAGTCCCGCCAGCTCAAGCCGGCGGAGAGGAACTACCCAGTGCACGAAAAGGAGCTCCTCGCCATGCGCTACGCATTGGTCAAGTTCAGGGTCTTCA
GGCCTCCAGCGCCAGGCAGCTGACGAAGATGATGAAGACGCGTGTGCGACGTGTGTGACGTCGGGGTTGAACTTGACGAGCGTCGCCCCCAAGATGCCGC
TTCGGGACGAGATCGCCGCAGCGTACGAGCGTGACGCGCAGTACGCCAGCATCCTGGCCCACCTCTGCTCTCCAAGAGACGACATTGAAGGCACTATCGC
GCTCGATCCGCAGCCACGTCGAGCGATATCGGCTTGATGGCTCCCTGCTGACGTACACCATCGACCGATTCGATGCCCCGAGAGTGGTGGTGCCGAATGA
CGAAGACCTTCGCGCCCGGATCATCCATGAGTACCACGACGCTCCGATCGGGGGTCACTTGGGTCGCGAAAAGACGTTCGCGGCGGTGGCGCGAGACTTC
TTCTGGCCCCACTTGTACAAGTGGGTGCGCAAGTGGGTGCGCACTTGCGAGATCTGCCAGCGAGTAAAGCCCTCGCCGTCATCGCAGGCTCCGCTGCGCC
CCCTTCCGGTCCCCACGGAAGCCTGGCGCTCCGTCTCGATGGACTTCGGCTTCGGTCTTCCACCCGACTCGAACGGGCGCACGGGAGTCCTCGTTTTCGT
CGACAGGTTCAGCAAGATGGTGCATCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCAATCAGGCGTTGACCTGC
ATTTGAGTGGCTCACATGAGACCAGGGGTAGCCGCCCTGGTCCTAACATAAAACAGAGTTGATTTTACCCAAGACTGACTGCTTGGTCTCACTAAATCCG
AGTCTTAACTAAGCTTCCTCACCGCTACGTGTAAGCTAGTAACGGACACACACCTGGCCGTTACAGGGGGCGATTGTGAGGCGAGGCGGGTGAACGCCTT