Description :
From Genome Similarity Track
Location :
contig_4:8769- 10552
Transcript NameFunction/comments
g1272.t1hypothetical protein

Sequence
1783 bases(100 bases per row)
ATTCTGGTTCTTGCTCTTCATCTATCCAGTACTTCGTCATTTCCTCAAAGCTGATGACAGTGCGCTGTTGTCTTGGTAGCGCTGTGATGTCTTCTGCTGA
AACTTGGATGCAGTACTCCGAAGTGTACCAGTAGTCATCCTGAGCGTTACATCTGTTGCGCGTGTGACCAATTGCACCACATTGGAAGCATGGAGGGCTG
GTTTCACGTTGACATGGTGAATTAGGATCTTGTTCCATTCCAGTTCAGGAATCTGCGGTCTACTAGGAAAGTAGGACATAGTTGGCTCTTGAAGTAGAAT
ATCCCAGGTATCAGTTTGCCTCTCGTGTGTTTCTGATGATGGTTCCTGCCACGTCGTGTACACACCTGTAAAGTGCTGCTGTAGGAATGCGTCCAATGCT
GCTTCATCCATGAACCTCGACACGTTGAGGAATCGAACATGGTATCGGTCTCTCGGTTTCTGTTCTCATCACGTACTCCATCTGCTCCCATTTGTCTCGC
CCAGACTCCAGCTGAGTGGTGATTTAGTGATTCTACTAGCTCAACAGGGGTTGAGTGTTCATTGCGGAGTGTGAAATTCTTGTGGCGGAACGGTAGAGTT
GTAAATTCGTTGCCCCACTGTGTCGCCTGCTCTCTCGTCCAAAATATTAGGTGGACAGCATGTTGGGCACGATCATAGCAGACTTGTTTTGCGCTTTTTA
AAAGCGCCACAATACGTTCTTCAGGGTGTTTACTTCTGCGCTTTCCAAGCAGTATCATGCCTACCAGTCTTTCTCTTGATTGGAAATCTGGGTAGACAGG
AAAATCTGGGGGTAGTTGGATCACTAGGTCTCCTTCAACTTGAGCTTGAATTGCATTCTGGATCATTCGCAGTGCTGGGTTCGTGGAGACTCGCTTGAGG
AATGGTGGTAAGTGTGCACAGAGGATGGTTCCTTCCAGAAGTCCCTTGATGATTGTTGCTTCTTTTTCTAACGGCTTGCGGATTTTGGTGGGAAATCCGT
AAGGTGTTTCACAAATTTTTCGGTATACAGGAATATCAAACGTTGAGAACTCACTACTCATGAATCGATACGGTGAGTTTTCCTCGCCCGTCATGTCGAC
GGGCTGATGTTACTGAGACGGGAAGGTGTTTCTATCATTTACGTACATGTAAGCGGACATATATTGGCATGATACTGTACATTAGAGAAATGCACCGGTT
TTGAGTTGGCTTCAAGCAGATGCTTTTCTCGAGATGGGGAAACATAAAGTAAATGACGACCTCAGATTAAATGACGGATGCCCCTGATAGCCCACGATAT
TTTCTCTAAAAGTATGAACTTTTGGACTTAGCGCTTTTGAAGGAGAAGTCCAAGTTCCACCCTGGTCGTATCCGGTGTCGTTCCGGTTTGACACCAAACG
AACACATTATCGCCAAGTTGCTACAAATCAAACCGTAAAAGATCTTTTATTAGTTGAAGTTTTCAAGAACTAACTACAACTACTTTTCCTAATCTCGTTC
GTGAACTACTTCGCATTGCTGGACACCAATTGCCTTGTACAAATAGCGCATACGTAGATAGGACTGCACCTCATAAAGACAGTCGGCCCACGCTCTCGGC
AAGTAGCAGTTCCAGAACAACCAGGCACCAGATGCCACACGAGCTGCTGTCTCTCTGAGTGCACCAGTCGATTTCCTTGTAGGTCACCTTGTCCTTTAAG
CCCAGCAAAGGCTCAATGACACACTGCACACTTGACTTCAAAGTTGCGAGATTCCCCTTCAGCTGGAGCGGGTCAAACGTATA