Description :
From Genome Similarity Track
Location :
Scaffold_217:87688- 90297
Sequence
2609 bases(100 bases per row)
TACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACGAAATACTGTATTACACGACAGTGGACCTTGCCTAAGGAGCAATGTGATGT
CATTGATGACTTCTACCGTTCTAAGCACGAGGCGGGAATGGTACGTGAGAGTAAATCTCGACATTCGACACCGACATTTTGTGTCAAAAAGCCGAACGGC
AAGTGGCGTATTGTGCATGCTTATAACAAGCTTAATACTGCTACGATTCCGGCACAGACACCCATTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTG
GTTGTACTATGTATATCGCACTCGACTTGGTCGATGGATATTATCAATTACTCATGCGAGCGAGTGATATTCCACTTACAGCAGTGAGCACACCAAGTGG
TATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATACTCTGGCAACATTTACGTCTGGTGACGCAACTTTTCCGCCCACATCGGGATTACTC
ACAGACGTACTTCGATGACATTTTTGTCCATAGTCGCGCCGAACAAGGTCGGTCAGATGTTGACAACCAGATCGATCATTTACGAGCCGTGCTAAATGCA
TTTTTGGTGCAGAGGAGATTCCTTTTCTAGGATGTTTCATTGGTAAACGCGTCCTTAGAGAGGATCCCGCTAAGGTCAAGACTATTGTGGACTGGCCGAT
TCCTAAGAATCAAAACAACTTGCTCAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGACCATTAACTGAT
ATCCTTAAGAAGGATACAGATTGGCGCTGGGACAACACCCATGCTGACGCGTTTTGGGCTATCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGCTGC
CAAATCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCCGATTTTTCTATAGGCAGCTGTTACAAACAGATGCTGCAGGTCGCGAGCGAGTTATCGCA
TTTGAATCTCGTCAGCTGAAAGCTTCTGAAAAGAACTGTCCATTTCAAGGCAAAGAGCTACTTTTTATGTAGTATGCGCTCGTCAAATTTAGAGTCCATC
TGCTTGGCTCCAAGCCATTCGTCTTCTATACGGATCATGCGTCATTACGCGCGGCGATACAGTAGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTC
CTTCTTTGCGGAATATAACTTCGAGGTGAAGTATGAGCCTGGCAAACAAAATGTGTTGGCAGATGCCCTTTCTCGCAGACCTGATTATGAGCTTAATCAT
GTCACGGCTGTGTCGTCTCCTATTGAGGAGTTAACTTTTGTGGCATACCCACGGGATTATCAGTGTGTGGCATTGTTTTATGCCCTTGGGAGTGAGGAAT
ACAAGGACTTGGACAGTCAATTATCAGCACGCTTGCGGGACAGCCTACATCGATATTACATCGATAATGGTATCTTGTGCTATCGCACAGATGTAGCGGA
TACAGCCCGAATAGTTGTGCCTCACAATGAGGATTTAGAGTATCAAATCCTCTTTAAGGCCCACGATACTACCCTCAGTGGGCATTTGGACCGGGAAAAG
ACTTATGGCTCTGTGAGTCAACACTAATTGTGGCTCAAACTCTACAAATGGGTTAGCACATACGTGCTTACATGCGAAAAGTGACAGAGGGTCAAACCCT
CAGCACACTCGGCTGCGCCACTCGCCTGTTTACCTGTGCCCAAGGGGTGTTGGGAGTCCATCAGTATGGATTTTGTGTTTGGTCTTCCCAAAGGCTGTGA
CGGCAATACGGGTATTGTGGTATTTGTGGACCGTTTAAGCAAGATGGATCACTTGGTGACGGTGCCAGATTCCATCGATGGCAAAGGTACAGCTATGCTG
TTTATCGATCGTGTGTTTTGTCAACACGGGTTGCCGCTAGCAATCATCTTCGATCATGACCCTCGCTTCACAGGCAAGTTTTGAACTTCCGTCTTCAAGG
TGCTTGGCACGCGATTGGACATGTCCACAGCGGATCATCCGCAGATCGATGGTCAGACTGAGCGAGTTAATCGCGTCTTTGGTGACGTTCTTCGCAGTGT
TTGTGCTGAGTCTCCTAAGACTTGGAACTCGATGATCCCTGTCATTGAGTTTGCGTTGAACAACGCTGTTCATGACTCGACCGGCTTTACTCCCTTCTAT
GTGAATAGTCTCACGCACCGTCGCTTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGGGGAAGAGTCTGCTGACAAGCATGCTAAAATCAGCC
CCATCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAA
AGAAAAAGCTGATGCTAAAGGCAGAGGATGTATTGATTATTATGAAGTTGGAGACCAAGTCTTATTAAACACTAAAAACCTACCTACAAATGTAGTGTCT
GCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGGTCATAGCGAAGAAAGGCATTGCCTATACACTCAATCTCCCGCGCAAGTTGC
GCACACACC