Description :
From Genome Similarity Track
Location :
contig_118:87678- 89405
Sequence
1727 bases(100 bases per row)
TACCGCAATGATTGCTCCATTCTCACTGGATCTGGACCGATCTGGATCAATGATGGTATGGATCACTGGGATATCCAAATTATGACCTCATGTCCGATCC
GGATCGCGATTAGATAGAAAGCGTATCAATTATTGACACGCTCCGGTACCTTCGATAGCAACCCTAACCTAAGTCAGGCCAATCGAGTTGATTGCATTCA
CTGCTGATCCACTCTGACTCCTCCTATTGCTTGCGACTTCGTTTTACGTCAGCCACTTTACCACATTAACATATTGTGACCGGCGGTTGTTTTGTCCTTT
TGAAATGTCGTTTAAATTGGACCTTGAAGGACAGGGGTGATATATTCATCAGAGGCAATCACAGTACTCGTCTTGGCAAGTTACCCTTCCGCATTGTGGG
ATGGATATGGTGAAATGGGGCAAATGACCCTTTCATAGATCACGATACGCCCAGATAATTTTATTCGCATTATCACATTGGTCAAAATTGAGTCCACAAT
AGGGTTATGTGACGTGAAGATAAATTGAAGAAGTTTTGTATTATGATGCTTTAGCTGTATTAAGATAGCTGAGTAAGGGTATAAATTGGGTATGTATAGG
GTTGATAGACATTAATAATTTATTATTCACCTATAGGAGCTGATGCCCTGCAATAGGCTTGATTTTACAAATATTAGCGAAGCAAAATGATTAACTTTTA
ATATAGACCAAACATACCACTCGCGGGTATGTAAATATGTTTTATTAAAACTCAACATAAAACAGTTCCAGAGGTCCTAAATGCCTTTTCATTATCTTAC
ATTTGATTTTTTGGACTAAGCGCTTTGCTATTCCGTTGAGCCACCACGCGGTTGTTTCATTTGATCAGAAGGCGAGGTCGGCCAGCTCTCATTTAAGGCG
TGGCAGGTGAACGCCTTTGTCGTCCTAAGGTGTGTATCGCTCCCAGACACACTAGATGAGGATGTCGGGACCACTAGATGAGGCTATCACCAGGTGTGAC
GTGTGACAATCCCTGTAGGTATCGTCTACAATCGGGTGTCTCGGACTTCACCTCTTTGAAACGGGTCGCTAGTTACACGATTTGAATACAGAATGAGTAC
CGGGCTTTGCTTAGACCAATTGAGTTAGACAGCGAGGCACGACTGAAGAGCAGACCCTAAACAGAGCTTCTTCAGACTAACTAACTAATACAGAGTTGTA
TACACTATAATATACAGCCACTTCTTATTCTTATAAACCCTTGAGTGGCGAGTCTTTACACCAGTCTCATTTGCAACTTTCACCCAGAGTACAGGTCAAC
GCTGGATACGTTCTCGCTCACGCGCACCCAATTCAAGGAGAAGGATGAGTCCCTCCAATCCAAACCCAGACGCTCGGCCAGTACTCCCCATTCCAGCTCA
CTTCACGGCAGGTAAACCGCACCCTGAGTTTCCCCAACGTGTCGCGAATCGTCCTGGAATGGGAATGTTCAATCATGCCGTATAGAAGCGAGGAGCTAGA
GAGGAGTCGGAACAATAGACGCAAGCAAAACGTAAATGCAAAAATACAGCTTGTTACGTTGGCTTCCGGGTAAATTCACGACTGATCCTTCTTCCTTACC
TTTGCAGCGAGAGTAAGCCGGCTCCTTGACCGCTCCAGTCATCCGCAGACCGCCAGCACATCTCGGGCGGCGGGACGACTGTACGCATGACACCCCTCCT
CACATTTGTCCTTGGTCTTCTTAGGGT