Description :
From Genome Similarity Track
Location :
Scaffold_1:87640- 90836
Sequence
3196 bases(100 bases per row)
TTTCCACGCGCCGATCCGTCAAAACTCACGACTAAAACCTCCTCGCCTTGCTCAACCGTCGTCGGGGTTGCGGCGATATTTGAACGTGGGCGCTTGCTTG
GTGCAACCGACGACAAGATCGAGTCGACGTTCTCCCGAGGGGTGATACTTGCTGCAATGGTGCCCAGAATTTCGTTCTCTCTGCGCGTACACTTGATAGT
CTCTAGCGTCCACGGCGAAACCAATGCTGCTCAGTTGCCCAGCCGGCCCTGCAAACACAATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGC
ACCCTGCTCGAAAACCCGCCGTTGACAACCCTAGGACTGATCGATCTCGTGATTAGCGTGGTGTAACACACGTCCAGTATCCTGAGAAGAGCCAAGATCT
CCATCTCAACGGTACCGTAGTTCAACTCATTGGACCTCAACGTGCGACTGGTGAACGTTACAGACATTTACGTGCCGTCGTGTTCCTGCATCAAGACCGC
CGAAATCGCCCAATCACTCGCGAAGACGACGATCACTGGCGTCCGAACGGGGTCAAAGTGTCTGGACACTGGTTCGTCTGCGATCTTGTTCTTCAGCTGT
TAGAACGCTAGTCGCGCTCGGACCAATTTGTCTGTTTCATCCGCCGAGGCGATCCGCTTCTCGCCCTCAGCAGCTCGATCGGGTTTCGGGTTCATTTCGT
GAAATTCCACTTCTTGCAGTTCATACAAGATCGACGCGTAGATTGCGAAATCATCAATGAATCTGCTGTTGTAGTTAAGGCTACCAAGAAAAGTCTGGAT
AGATCACGGTGCTCACGGGAATGGCAAAACCGTCAGAGTCTCGAGGTTCTTCGGGTGCGTTTCGAGGCCGTCCGCGGACACTCGATGTCCCAGGTAGTCT
ACTTGGCGGCAGCCCCATGATCTCTTCACCATGCTGATCGACAAGTTCCAACGGTCGCACGCGTGTAGCAGTCGATCGATTCTGGTGCAGAGCTCGTTCC
AGGATTCAGTGGTCACCAGAATGCCGTCGATGTACGAGCGACGTCCCAGCACAGGCGGTCCTGAATGTACGTCTGGATCACCGATCTTGAACGCATCCGC
CATACCTGACTGGTCGCCTTCTTCGCGGATCCGAAGATAGCCATACAATGCGTTGTCCAGATGTCGCTGGTAGATTTGAGGGACGTTCTTCAACCCAAAG
CGCATACGCAGCCATTCAAAGAGACCAAACGGCATGACGAACGCCGACACCAAACGCACCCGCTGGGGTCGTCGACATGACCCAGAAACCGCTCGCCATA
TCTAACGAGCAGTACCAGAGTGCCTTATCTAGGTCTTCCAACAGATCGTTGATCAACGACATGGCGTACACCATGAGACGTATCAGGCTGTTCACCACGC
GGCAATCGATGCGGAGTCTAATGTCGACCCCATTCCTCTTGACAATCACCACGATAGGCGACACCCACGGCAAGCTAGACGTCTTTCTGATATGGGCAGA
CCCTTGATCAAGCCGGATAAGTTATCTCGAAATTGCGGCGCAACTCGACGCACGCGCTGATCCACTGGCTTGGCGGTCCCAGTATCGATATCACAGTAGA
CGCCTCGCGCGGCTGGCGGCAGGGCGTTCCCTTCTCCGAGAAGAAGATGGTGTCGGCTTCAGATGATATTCCCCAACCTAACTTCATCCGCTGGCGCGAC
AAAGTCCTCATACTCGATTCGGACGTCTTCAAGCTTCACATTTCCTGGCGTTGTCGTCCCCTCTGGCAAGATTACCAACTGAGCGTCTACGCCTTCGACA
AAGCGTTTGCCCCCTTCGTTTATGCAGACTTGGTCAGCCTCCACAGGGATCGGGCTTGACACATTCCCAACCGGCTTTACTTCCATCTGATTCACGATGA
GATCAGCTACTACGTCCACCCCGCTCCCAGGTTTGCTGACTGGCGTGGTCTGCACATCCTCGAACCTGCCGGTGGCGATTTCGCCGTCCGCCGCTGTCGG
CCCATCGATCTGGTCTTCTGGCGCATACGTTCGCGCGGTCTGCGTTCGAGATACTTTTCTGACCATGACTTCGACCCTCCTGACTTCGGGCGCCTCCGTG
ATATGGCTGCTGCCGGCCACCCGACCTATCGGTCGCCTTAGGATGCCTGTCGGCGTGTCATACTGCGGATGAGATACCATCGGCTCCGTCGACTCCCCGA
TCCGATTATCTTCCTCGACTGTCACATCTGTGGTAGCCGGTAATACCAGATGCTACCACTATGCGTATCGACGCGATCCTACGGTGATGAATCCTTGACG
TCTTGGTACACCATCGCCTGGCAGCCTCATTCCTACCGAGGTATTAAGGGAACATACAGGCAGCTATTTCGTATAATTCGAATTGTGGTGCTTTCACCCC
CGATAGTGATTCATGCTGCTGGCTCCAGACAAAAGGCGTTCCGGCGTAAAACGAACGATGTGGCAGTTCGTCCAACGCATCCGCCAAGGTCTTCAACTTG
CGCTCAACCGCTATCTTCCAACACTACTCCTCGTGGGTGGTGCCGCGGCCCTCCTCATCATGCAGCCCCTGAGTCCGAATTTGGTAAGCCTCGGTCCCGC
CAACGTCTCCGTCAATACATCCGCTCGCATTCTCTCCGCCTCGCGGTAACTCGGTGCTAGCGCCCTCCCTGCGCGTAGTGCGACACGAAGTTGATCCTCA
CATCTCCATGCTTAGTCGTGGACGCCACATCCTCTCCTTCAAGCTGCTTCAGCGCGGCCTGATTGTCCACTCGTAACATCTTCGGTTCTACAAACGCCAC
CCTCATCTCCTCCAGCAGTTCCCGCACGCCGAGTAGTTTCTGTCCCATCACAGAGGCGGCTGTGAACTACCTCCATTGTGGAGAGTGACACATCTCCCTG
TTGCTTACGGACCGCCATATCGTCCGCAGTAGCCAGACCTTCAATGATTTACTTTCTTTTGCAATTGTCGGCAGCGCCGTCCGCGTCACTGTACATCACC
ACACGAAGCCGCTCATTTCACTTTTCACCTCCTTACATACCCAGCCACATTACCTGGGTCCCCGCCAAGTACCTCAAAATCCTTTTGGCGAGTTGTTAAT
CCACCGTTACATATGTCGATGCTTTGTGCACTACAAAAGCAATATCGGGACGCGTACAGCGCGGTACCCACAAAAGGCTGCCTAGGAGAGACTGGA