Description :
From Genome Similarity Track
Location :
Scaffold_736:8764- 11005
Transcript NameFunction/comments
Phyta_totarag10444propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2241 bases(100 bases per row)
cgcctgcaccagcagcccCGCACGGGGGAGAAGCTCTTCGACAAGATCCTCGTGGCCAATCGCGGCGAGATCGCCGTGCGCGTCATTCGCACGTGTAAGA
AACTCGGTATCAAGACGGTAGCCGTGTACTCGGAGCCCGATGTGAACTCTGTGGCCGTTCGCATGGCTGACGAGGCCGTGTGTGTGGGACCCGCGCCCTC
GAGTCAGAGTTATCTGAGCATCCCCAAGATCGTGGAGGCCGTCAAGGCCATGGGCGCGCAAGCCGTGCACCCAGGCTACGGCTTTCTGTCGGAGAACAAG
GACTTCTGTGAGACCTTGGAGGCCATTGGCGTGGCCTTCATCGGCCCTGGTCACGAGGCCATCCAGGCCATGGGGGACAAGATCGAGTCCAAGCAACTGG
CCATGGACGCGGGGGTCAACACCATCCCGGGCTTCCTGGGGGAGATCGACACGCCCGAGGACGCCGTAAAAGTGGCTCAGGAGATCGGGTATCCCGTCAT
GATCAAGGCCagtgctggaggcggcggcaAGGGCATGAGAGTCGCATACAATGACGAGGAAGTGCGCATGGGCTACCGACTGTCGAAGGAAGaggcggcc
agcagctttggGGACGATAGGATGTTTCTTGAGAAGTTCATTGAAGACCCACGACATATTGAGATCCAGCTGATCGCAGACTCGCACGGAAATGTGGTGC
CACTGCCTGAGAGAGAGTGTTCGATCCAACGTCGGAACCAGAAGgtgattgaggaagcgccgagtgtgctgctggatccAGAGACGAGAATGGCCATGGG
CAAGCAAGCGGCCATGTTGGCCAGGAAGGTGGGCTATGTGAGTGCCGGTACAGTCGAGTTTTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATG
AACACGCGTCTGCAGGTGGAGCATCCCGTGACGGAGCTCATCTCACGCGTGGACCTCGTGGAGCAGATGATCCGCGTGGCGGCAGGACATGAACTGCCCA
AAGAGTTGCTCGGCGGACCTGTGAAGATCCACGGCTGGGCTATGGAGAGCCGAGTGTACGCTGAGGACCCGGTGCGTGGCTTCCTGCCATCTATCGGACG
ATTGCTCCAGTACGAGGAGCCCATTCACCTCCCGGGTGTGCGTGTAGACTCGGGTGTGAACGAAGGCAGCGACATCTCCATGTTCTACGACCCGATGATC
TCGAAGCTGATCACTTACGGCAAGGACCGCCCTGAGTGCTTGGATCGCATGAAGATAGCACTGGATAACTATGTTATCCGCGGCCCTGGCAACAACGTCT
CGTTCCTGCAGGATGTCTTCCGCCACCCTCGCTTCGTGAGCGGCAAGATCACCACCAAATTCATTGAGGAGGAGTACCCGGAGGGCTTTGATGGTGTAAA
GCTGACACCACCCGAGATTGAGGATCTCAGGGTGGTCGGAGCGATCATGCACCTAAAGAAGGCTGGCGCTAGTAGCCAGATTTCGGGTCGCATTCAGTCG
ACACCCGTGGAGGGTTTCGCTTCGTTCGACTCCCtcaacgaagacgaactgGAGTTCATTTCGGACCAAGCAGGAGTTGTTCCCTGCCTACGTGCAATCG
CTCCCGGTCTATCTTCTAAGGAATTGATTGCGCTCGCGGAGCGCAACGACCTCAAGAACGTGGGCACTCAGCTGTCTGTTAGCATTGATGGTCCATTTGG
AGAGCCAAAGCCCGTTGTGGTAGTGGAGGTTGAGGTGGAGAACAAGCGCCGCCGCACTGAAACGGTAACGCTGGCTTTGGTGGACAACAAATGGCACGTC
GTGGGCGATGTGGACTGGTCGCTCAACGGGCCGCTATTCAAGGCATCGTACGCAAAGCAGGACGGTGCAGCAGACGTGCCGTTGGCATCGCAAATGCTGC
AGACGCTACCTGAGGGGTTCCGGCTTCAGTTCCATGGTGCTGTGCATGATGTGGTCGTGCGCAATGAGCTGGAGGCTGCGTGTGGAAAGCACATGCAGCC
GAAGCCTGAGGTCGACACATCCAACTTGCTGCTATGCCCGATGCCCGGCATGCTGATTTCGGTGGCAGTGGAGATTGGTCAACACGTCGAACTAGGCCAA
GAGCTGGCTGTCGTAGAAgccatgaagatgcagaacGTGCTTCGCTCCGAGAAGAGGGGCGTTATTAAAAGCATTgtgcgcgctgctggtgactCTCTCA
AGGTCGACGAGATCATTCTCGAGTACGAATAAGCGCTTTGA