Description :
From Genome Similarity Track
Location :
scaffold_83:8763- 18402
Transcript NameFunction/comments
g3056.t1hypothetical protein
g3057.t1hypothetical protein
g3058.t1 hypothetical protein PHYSODRAFT_493974
g3059.t1 hypothetical protein PHYSODRAFT_354317
g3060.t1hypothetical protein

Sequence
9639 bases(100 bases per row)
AGGCGCGTAGTATCTGGAACACACATCGGGCGAGTTTTGCTGCAAAACCCACGCGATTCGTTGGGGGAGAACTGCACGCGTCAAGTTTTCCATAAAAGCG
CGGGATTGTAGTTTCCCCCTCCAGGAGCTTCCTAGCATCTCTTCGACTTCCAGAAGTTGCTGTGTTAGATGGACCATCCAGCAACTAAATCGAGGTGAGT
CGTAGAATGTAGCAAGCTCCGTGTTGCGAACACAACGCTCCGGCTCAGATAACTCTGGTACTCGAGGCATTGCCTTCCGTCCTTCGTTACCTACACCCGG
CAAATCACTTTGCCTCCACATAGCTCGTTCGACATCATCAAGGCGATGGTTCCCGTGGGGTATGAAGCAGGAGTCCCCTTCCTCTTGCAATGATTCGTGA
TAAAGCTGAGCACCTGCAAGTCGGCATGAAACTAAGTCGCCATACTCGAGGAACTCCTCAAGTTGATGTGGATCTGCCTTGTTATTTGGACTGGTACGGT
GTTGTGGAACTGGTGTCGTCACAACGGGAGATACCATCGCCACAGCCTCAGCGATAGCAAATAAAACCGTACTGACGCCAACACTGCCAGGATAAACACC
GCTTAGCACTGATCCATACGCTTTGCAAAGCGCATCCCAGTCGCCCTCATTATCAGCCAAAAGAGGAAGCTCAGCAAATGTTGTTGACCCTACCCAGTCC
TTAAATGAGAACTTCTGAGCAGCAATCGACTCTACAGTTGTGATCAGCTCCTGCTCAAGCTCGTCAAGCGGTTTGAGCTCCGACGCTTCTGTGCTGCAGC
CTACGTCCGTGAAAGTAAAGTCGCTCCACTCGAGTCCTCCCGCCTGAGCAGCCTCATAAAACACCTTCACAACAGAATTTGCTACCTGAAACACCGACGT
CTCCGTCATCGACGTTCGTGGAGCATTGCGCATTTTCACAACAGATTTACGAGGCGGATTAGTTGAGCTGCTTCTGTTTCGAACCCGACCTGCTGACACG
TCCAGAGGATCAGCTAGAAGCACCACCCCGTCAATCAGCGGTAACAACGGCAAATTTTCGGGTCCGTTCGTACTGCCAACCTCTCCCAGCCTCAACAGTT
CGTCTATCTCGGACAGGGAAGAAGGGTAGTCCACTAAGAGGTATACGCGCGCAGGTGTCTGCACTGATTCTCTGTTCCTCTCCGCGTACTTTTCTTCTGC
ATCTCCCCCTCCTTCATCTGGATGTGCGTCTGTCTGCTGATACGCGAGAAATTCTCGCTTTTCCTGACTGACAAGACGCTGGAACGCGAGTGCCAGCAGC
GACGGCGTCACAGTAACTCGCGCAATCTCTTCCTCCTCCTTCTCCTCTGCATCTCCTGGTCTAGCACCCTCCTCTACAGCAGTGTCCTCCTCAAGTGCCT
TATCTTCGTGCTTTTTGGCCTCTAATTCCTCCGCATACGTCACTTGCACGAGCTCCTCCAGCTCTGCGCGACCCACGACGCGATACGAGCAGCTCCTCGC
CCAGCTCGACAGCTCTGCGTCCGCCTTCAGCCTGTTCAGCAGCCCCTTTCTGGCCGCCAGCTCCTCGTTCGCTGAGCCGCTGGCGAGCGCCACCGCGTGG
AACCCCCAGCGCCTCCTCATCATTATCGTTGAAGTTGGAGGCCCAAGTGGAAGTTGTCCCTCTTAAGTGCGATCGAGCCAAGTCGACTCAGAAGCGGATC
AGACGGCAATGGTCCTCGAACGTCTGCTGCTCGCGGCTTGTGTGCTCGTTCTGGTGGCGGCCGATGCTCCATGCGACGAGAGGAAGCTGCACCGAGACGC
TGTGGTGCTACTGGCAGCTCACGTGGACGTGGAGATGGGCGGCGTCGGAGCAGGCAAGCGCGAGGTCGTGGGTTTTCAGTATTTGGTAAGGAAATGGTGA
AAAACACTTCAACAACTACAAATCGTGTTAATTAACGGATGATAACGACGCAGAAACCTGCTGAGGCTCTTTTGGCAGCACAAGCGCTGGCTCATGAGGA
CTTCAACCAGGCAGCGGGACAGGTCCAGCGGATCCTCGAGTACCAGAAGCCAGACGGGTTACTGCCGCACTTGGTCTACGGGCCGTCCGTTCCGTCCAAG
CTGCGGTGGATACCGAGCAATCGCACCTTCCACCCAGGTCCAGCGTTCTGGCAGCAACCGCTCGAAGGTCGGGAAGAGGAGAGCCCCATCTCGCCCCTGC
ACACTTCGACGATTTCGGCTCCTCCTGTGGCTGCAGATGTGGCGTGGGAAATCTTCCGCTTGTCTCCGTACGACTCGGTACTGGGTGTGAGGACCACCGC
TGTGCAGTTCTTGTGCAGCGTTTATAAGCCGCTCAAGAAGCTGCAGGAGCGCTTGTTCTTCACACGGCGAGGCCCCTCTCCTAGCAGTTTACTTACTGCT
CGTGTAAGATTTACTACGATCCGTACATGACAGGATGGAAACTAATGCTCAGGTGTATCTTACGATCGTTCTTGCAGCACCCCTGGGAAACGTTTTCGCC
ACTATCACCACACTGGAAAGCATTTCTCGCTGAATTGAAAAATGCGCCAGACTACGACGCAACTGTCAAGGCTATCCCCGACGAAGCCCGAGCTCGCTTT
GCAGCTGGAGCTAGTACAATATTTTCAGCGCAAGACGCAGTTGAGAATTTGTATGAGCCTATGATTTATCTCGCAGCTCAGATGCGCCGCGGAGAAACCA
GCGAGAACTACCGTCGCGAATCAACCGTGTTGGAGTCCATCGCCTACACTACGGATGGTGACAAAATTGTTCAATTCGGGGTCGAAGATGTGGAATTCAA
TGCGCTTATGCTGCGATCGTCTTTGGGTCTTGTGAACATCGGTCGCGTGCTCCTGGAGCACTCGTCCGTGTGCACGGGTTTCACGTTATCTGAGGAAGAG
CTTCTGAGTGATATGAAAGAGCTTCATTCGATGGCGAAGGGCCTCGAAGGGGCTCTCATTGGCACCAACACCACTCAAGGCCTGTGGAACGCATCCGCTG
ATTTCTTCGCTGACTCTAGCAGGTTCTCATTGACCTCAGCGCACTCGTTGCGCGGATTTCTTCCTGGATACGCTGCAGAACTGGACGATGACAAGAAAAT
GCGCGCGATGAAGCATTTTCTTTCGGAACCAGGCACATTTTCTTTCTTTTGCTCCCAGTTCCCAGCTTCATTTTTTGCGTGCTCTGGAGGAGATTCACTC
GAAAAAGTTGATGGATCGACGAGCGGCAGACCAGCAGCCACAACGTGGATCCTCTACAACTATTTTTTGCAGCGTGGGTTTGCTAGGGTACGTGTTACTC
CCCACTCCGAGTTTTGATGAAAACATTAACTTTGTATAACATTCAGAACAAGTTTCCAGGACTGGCTGATTACATCCGCAACAAGACTCGAGATATGGTG
TGCGAGGCAACAACAGCTTCTCCTCAACCATCTCTTTCGTGGTTCTCATTATCGTTAACTGCGAATGAGGCCGCACCCACAGTTCTATCTCTAGCCTATG
ACTCCCACAACGCCACACCAGTCCAAGTTTTCGACGAGAGTTATATCGGATCAACGCTCTCCGCCGCCGCACTTCTTAATGTGCTGTTGCCAGCAGGTAC
AAGTAGTAGGCTTTGGATACGCAGTGGTTCTCTACAATGCCTTACCGGTAAATTTTTTTTTTTTGATGTCAACAGTGACTCCGCCACCAAGTCCAGATAC
GCCACCCATTGATCACCGCATTCTCTCTGTTATCATGTGCGTCGAGCTAGTTGTCGCGTTTGGAGTCGCGATGAGCTGTTTCCTGTTTTCGGTATATTTT
GTGGCGAATCGGCCACGAGAAACACGACCATCGTCTGCGTCTGCAGCACGCCAAAAATCGGCTGGAGGAAAGAAGCCTCGAGACAAATTGGATCGCCGCA
CGGAAGACTTGGAGGGCCGCGAGCAATCCAGTGCCAGTGGGTCGTCGTGGGCTGAAAGGTACTCGGAGTCATCTTACAGTGACTACTCTCCGCGATCTGG
CCACACGCCGTATGAGCTAGAGGAGTCGTTGATTTCGGAGGAGGACGAGCATTACGGATCCTTCGACGAGGCAGCACAGCCGGAGACACCGTCCAATTCA
GCATGGAAAGCCGCGAAAAAGGCGCTAGCGGACATCAGTCCCTGGTAGATACATGTATGATGCCAGACAATCTGTTAAGTTCATTGCACAATGAACACGT
TCCCGCACACTGGTGATCCCACTTGGCATTTCTTCAAACTGATTGCGAGCCTACAGCAGATCCTTTTTCCACTTTGCCACAAGCTGTGTGGCCGCCTTGG
CCACCGATGGCGTGGAATGCTTGCGCAACTTGTTGATAGTGCGTCCAACACCTGTGCTCTTCAGGATATCAACCGTGAGCACCATGCCTGCGAGTGTAGT
CAACACATGCGTAGCCAGCTCAGCTGGAACATTCTTCACGCTGCCAGTCTGATCCAGTAACCCTTGCAGGAAGGCTACACGTGTCGCCACATCTTCGGTC
TCGGCTGGGGCCCCAGCACTTGACGTCGGCACCTCAGAACTTGCACTTTTGGTATCGCCGGTAGTGTGTGAAGTTTCCTTGGTGCTCTCTGCAGTGGTAG
CCTAATTAAACAACAACAGTGTTAGAGCCAAGAATTGCAGACCGAGTCCAGAACGTTATATACTCACATCAGGAAGTTCAACATCAGCATTTAGGTGTAG
TTCCAGAATCAGGGTAGCTTCTGCAAACGCAGGTGCGAACCCCACTCGATGAGGCTCGCACAGTGCCCACAGCGCTTGCATAGTCGAGAAATACCGCTGA
TTGGGGTCACTTGATGTATATTTGCTCGCCCAGGATCCATCCTCGCGTTGAGTAAGCAACAAGAACGCGAGCCCTCGACGCATCTGTACCAGATTGCTAG
AGCCTTCGAAGCATCGCAAAGCCTACAAAACAGCAAGTTATCGAATTAGTGTCGGATAGGGCTGCAAAAGAACTCGGAGCGCGCGCTCTTTTACCCGCAA
TGTTTCCCCAAGTAGAGCCGCATCTTGCTGTGCCAGGTAATAGACAATGTGATGTCGTAGAAAGAAATACTCATGGGGTAGAAGGTCCTGTTAATGAGGC
AAGAACACGTTAGTACAAGCAAATAATAAAAAGGGAGGGACATGTATCAAGAACCTACCGTCTCACAGCGTAGTTTTCCATGGTTCGTGAGCACAAACAC
GAGTGTTGTAACCAAGTGCACTTGGTCTTCATATTCACGAGGTGAGAGACCATTAGGCCCCTTGTACGGATACAACGGCAGCAAGTGTTGCAGCAGTTGC
GGCAAGGAGAATCCGATCGATATCCCTAGAGCGTTCGAGTGATGCCATAAAACGAGGGCACTCGTCAGTCGCTCGTAGATCGATCCTCCGTTTTCGCTAT
CACTAGATGGAGGGCCCTCAGCCGGGTTCCAGCCGAGAAGTTCCTGTACAACAGCAAAGACAGAGTTAGTTTGCTAGTCGTTCAAGCGTTTTCATCCAAA
GGCAGTTTACCTTGGCTCCGTATACAGGAGGCGATCGATCACAGAACTCTAACAGCTCTACACGCCTCACGTGGGAAATACCCAGTCGTTCCACCAAGTA
AACGGCCGTAATAGCGTTGACGAGCTGCGTGGGCGTGGGGACGGTACCAACGGCCCAATCTGCATGTCGGTCCTGCTTCAGCCACAAGGCGCCGATGAGT
CTCGCGTACAGTGTGGACAGTCGCAGCACCTCGCCCTCCTCCACTGCCTGCAGGTCGTACAGCGACTGGATGGCGTGCAGTCCCCAGTCTGGAAAGCTCG
CAGCTTCACGAACCATCTGGTAGACACAGTTGAGGCCCTTCACCATGCTCTCGCGTCTCATGACGATCTTCCAGGGCTCCACAGCCACGCGCTTGGCTAC
TTTCTTGGCCTTGAGTTTGCGCAGCTCCTGGTGCATGAGCCGCTTGAGCACGTCCTTGTGGGTCGACAGACTCACATGCACTTCCTTCTCCACAGCCTGG
CGCACCAGTTTCGTGGTTAATTTGGACACGTCGTGGGTAGCGATCACGCCCGCAATGGCCGCCGCGATCTTGGCCTCCAGCTCCTTGGAGATCGTGCGCG
GGTTGACGATGAGGGACGAGCCCGTGGACGTCATCTTGGTGTACATACCCCCCGCCATACTCGAGAAGCTACGCTCAGCAGATAAAAAGCAGATATAACC
CAGGTTATATCATTGCCACGTGGTTAAATATTTCCACCAATCACAGACAAGGCCTCGCGTGTGTGGCTCTAGACCCGCTCTCCTCCCGTCCCAACTACAA
GATGCTGGCCCGTGCTCTCCGATCGTCCACGCTGTCGCGCGCTGCGAGCCGCCGCTTCATCGGCGGGTTCGCTGCTGATGCTGCCGCGCCCACTGTGGCC
GAGAAAGTGTGCGTGCGCCTTAACCCCGTGTAATAACCGCATCCGGAGTAGGTTTTGACAGCGTTCTGGTGGTCTTGTGCAGGGTCAACGTGGTGCTCGT
GGACTACGAGGGCAACCGCCACGTAGTCAAGGGCCGCACCGGCCAGACGCTGCGTCAGGCCTGCGAGATGAACAACGTGGGCTACGTCAAGGACGACTCC
ATGGGCGGCGGCGGCGTGTACGACGCCAAACGCGCCGACTTCTACACCGAGTCGCTCTTCGGCGAGGGCTCCACGTCCCCGCAGTCGCACGTGGTGGTGT
CCAACGAGTGGATCTCCAAGCTGCCGCCCGCCAACAACCAGGAGCGCCACATTATCGACACGTACGTGCCGGCGGAGGACCGCTCGGCCAACTCTCGTCT
GGGCACGGAGATCGTGCTGCAGAAGGACCTGGACGGACTCGTCGTGGCTGTGCCGGAGGCCCCACCTGTCGAGGAGTACGAGTACGACCACGAGTATGAC
GAGGATGATTACGAGTCGTACGATGACGAGCACCAGCACGCTTAAAAGTAAGGAAACACTGTGGATGTCTGTGGGAGAACGGCATGTGAGCTAACCCCCA
AGTCGACGCCAGTCTGTCGAATCCGCCACCACAAGTAACCAAAAAAAAAACGAGAATACAAGGTAACAAAGCGCGTTGGGCTGTATCTAACACTCGCTAG
TCTTTTGCCTTTTTCTTCTGTGCAGCTTTCTTCTTCTCGAGCTCAAGCTTCGAGCGGTTCTTAATATCACGTCGCTTCTTCACTGTGTTGGAGTCGTTTG
GTGCAGTGGGAGGCTTTCGAGCTCTGGTCGGAGGCACATCGCTGTCACTGCCGTCCGTGTTATTCCCAGCACCGTCGAGTTCGTCTTCCTCATCGTCACA
GCATTCTTCCTCGTGCTCTTCGTCCAACTCGGAGTCCACGTACGGGTTCATTTGACGCTTCTCAGTGCGCGACACTCGGATGTTGTAGCGCACCTTGTCG
TCGTCACTGCGCGTATCCGACGGAAGACCAGCAGAATCCGGTTGCCCAGTGAAGCTGACCATCCGAGTGGAGTTCCTGTGCCGGAAGCTGGGGCTGGGTG
CTGCCTGGAGATGAGCTTCCTCCCCGAGGACAACTCGCACCACCTTTTCGATCGAGTCCACGAGTTCCAACGCATTCAACTGCTGGACACTCGTCACGCC
CAAAAGCTGAGCGATGTGCAAGAGTCCGAGTTGCAGTCTCTCCTGCAGCGATCGCAGCCGTGCAGCACGCTCTTTCTTCTTCTGTTTGACGGCGTTCGCC
TCAGCCAACTGCTTCTCCAGCATCTTGACATTGACGCTGGCTTTGGAAGCTGCAGCATCGTCCTCCCCGTTCGCGTTGGCCCCGTCCTCTTCTTGAGAGC
CTTCGACTCTGCCACTGGAGCTGCCGCTGAGCTTGAGGTTCACGAACTGAGTCTGCAGAAGCTCCAGCTTGTCACGGTACTCGAGCACGCGCTGCTCTGC
CTGTTTCTCTTCCTCTTCGAGCTGAATTGAGTGCTCAAGCTGGTTTTGCCAGCACAGCAGAGCTTCCTCTGGCTTGTTAATACCAACTTGTCGGAGGGCG
CCCAATATTCCGTCGTCCTTGTAGGCACTCCCCACGTACAGTTGCAGATTCTCCGCGTACTTGTGTCGGACTAACGATGTCTCCTTCATGTGGATCAGCT
TGTCCTTCGCACGAAAGAAGTCGGGGTCGACAGGGGCAGTTTGAGACTCATCGTCTGCTGCGAAGCTGACGCTCGCACGGGTGGCCCCTACGGTAGCAAG
GTTGGTACTAGTGTTGGGGACGCTTTTCTTCGGTGGGGAACCAGAGGCGTTGGGTTTCAGGATCTGCCCAGCATCCTTCGCTGAAAGACTGGCGTAGTAC
AGTCGCCGGTCAAGTTCCTGACGCCACCGCAGTCGCGCTAATGCCTCTTGATGGATCGAAGCCTTGTCTTGAGTGACCTGTACCAGCTTTGGGACGTCCA
GACTCGCTAGCCGCTTCTCATATGACACCACCTGCGCCTTCTGTTGCAGCTCCACGATCTCCCGCTTCAGCTTTGCCACAGTCGCCTCTGCAGTTTCGAT
TGTATTGGGGTCACGCGCAGGGTTCAATTCGCAGTGGCGCAGGATCAACTTGTAGTATTCACTGCGCTGACGCCCAAGAGAAGCTTCGTCATTCACGTTG
CGGATACTTTCAAGAAGGTCGTCGATCTGCGAGGCGTTTTTACCCGCTGCAGTGATCTCTGTTTTCGCGTCCATTACACGCGAGTCCAGCACTTTAAGGG
CGTCGCTCTTCTCCCGTGCAGCAAACTTGACCCGGTCGTACTTCATTCGGAGCTCCATCAGTTGGCTCTAAAGTCACGCAGCAAACGCATTAGACACGAG
ACTCATCAGGCAGTTGCAACCAGCACTTTGACACGAACCTCGAGTTTGGAGACGGAACCCAAAGAGCCCTCGCTATTCTCTGCTGACAGGAACTCTAGCG
CACCCATTTCGTTGTCTACAGAACTTTCAGGTCCAGTCGAAGGTGAGGTCTTGCGTAGCAGTCGTCGTTTTGCTTGAACCATTGACTTCTTGGATTTGAC
GATTCCTTTGGGCAGAACGACACCTACAGGGCTGTACGACGCCTTCTTCGTAGCAGCAGCTCCTTTCTTTGAGGGCAGGGTCGATTGGTCGCTCGATTCG
AAGCTATTAGACTCATCTCGTGAACCAGCAGCCGAGTCGTTTCGACCACTGCGGAAGACACGACTTTCAAACGCCGTACCGATCAGAGGGAACTGGGTCC
ACAGCCACCGTCGAACATAGTAACCATCGTCTTGGTGGGCCCCGAGAGCATCGATCTCCTTTTGCACCCGTTCTGCCTCACTTTCTGATAAGCTCGACGT
CGAAAAGCTGCCTAAGCTCGTAAGGAATTCCTGGAGTTGAGGCGGCTTGGGTCGATTGAGTAGAAGGTTGACCACACGAGATTCGTCAACTTTCTGCCAC
GCTCGCAGGAAATCGGTGATGGTGAGGAAAATGGACAGCAACTGCTCTGCACTGGGCGATTCTTGGGCAATGTATTCATCTAACGACCGGATGAAGTCGT
CCACCGGGTCGTGCATGGAGCAGTTCGACGACAAAACCATCCAGTAGAAGAAAAACTCTTGGCGATTCCGCTCGCTCCACCACAACTGGAACATTTTCAT
GTTCACCAGAGCGTTCTGTAGTACCCCCCACATGGAGCA