Description :
From Genome Similarity Track
Location :
Scaffold_5:876252- 888490
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04594hypothetical protein

Sequence
12238 bases(100 bases per row)
AGGATGATGTCGATCTCGTCGTCACGGAGAAATTCCTCCACGCTGAACACGAGCGGCGTCATACTGATCGTCTCCAGCACGAGATCACCACGGCCGAAGG
TGTTCTTTACCAGTGCTGCAACAGAGCCAGCAAGAGTGCGTTAGAAAGCGAGACATCGTTTACATCTCTGCCATCTCAACAAAAACTTACTCTTGTGTCC
TATACGAATTCCGGGCCAGATGAACTGGCCGCCCTCGAACAAGAACACGATCCGATTTTGCAGCACGGTGATGTTCTTCTCCAGCCTCTCTCCATCTGGA
GTGAAATACGCTGGTGGTTGCTTGTACTTGCGAGCATACTCATCAGTCGGCTCTGGAATTTGCAGAATTTCTTCTTCCACCACACGTGTAAACGCCTCTA
GATCCCTTGTCGTCTCCTTTGAGCTGTTTGCATGCATTCCGTCCTTAAACCCAGTCACTTTTAGCCTACAAAAACACGTATACATCTGCATTAGCCTACA
TCTTTTAGCTGCTAAGAAATTGCTCTCGCATTGACGCACGTGTCACTCGCCGTCGTCTCGATGCACAACACGTGGAACCCCTTGACTGGCATCGTGTCTG
TCAGGAATTGGTGCGCATCGGCGCAGTCCACCGCGACCTCACTATGAAATGCATCAGGCACGTTGGTCTCCAGTAGAACGCGACGCACTGCGAGCTCCAG
AGCCTTCGGATCGCGAATGCACGTCGCCACTGCGATGGCCAGCAGGGCCACCACCAGCCACGAGAAGGAGGAAGCGGAGGAAGACGGCCGCGATCGACTC
GCCATTATGGAGACGAGGAGGCCAGGGCGCGATGAACAGTGAAGTACGCAAGGGCCATGTTCAGAGCAGCAGGTCAACGGATGTCAACAGTGAGATGACC
ATATGTTGCCGTGCAACTTGCTGTGCGTCAACGTTTCTGCAAATCGACGATCGCTTGCTTTCGTCTCAAGACTCTTGCATCAAGACATCGAGGGCTCTTG
ACTCACGAGCTCTACCAACCAATTGCCCCGTTATCTGAGCGCATTATTGCCCATATGGGTTTTTATACAAATGTACCCATCCAAATTTGGGTGAATTGAC
AGAATTTATCGGTCGCAAGTTGGAATTTGCATTACGACCAATAAATTCTGTTAAGGGACTAGGTTTCTGCTATTGTTATTAACTTATACAAGTTATTTTA
AATCTCTGTAAACTTATAAAAAATATATCTCTGTAATCTTATGCGAGCTCAAATCAAAGTCGTGAAAAAAATACTTGTTTTATAAGAAGCGTTTTCTTTT
CTGAAAATGTTATTTTGTAGAGAAATTAATTAAGGTAAAGTATTTGTACAAGAAAGCTAAATTTGAATAATTTTTATAATGCCAATTTAGCTTTTTTACT
TGAAAGTAAGTAAAAAGTAGTTCAATATATTACTAGGTTCTTACAGTAGTATAATATCCAGTTATTTAATATAAATATATTTTTTATTCTATACATGTAG
TTTCTAATAATAAAACAGATTTTATAGACTGAAGCTTCCAGCTTTTTAGTATTGAATTCAGTACTTTTCAATTAAAAATGCTAAAAGGTAGAGTAAGGCC
TGTTCTGAGCGATGCGTTTTCTCGACGCATGCATCGAAAACACGTATCACGCGTTTTGATTGGCTATAAGTGTATCATGACCAGTACACCGTGAACGCAT
GCGTTGTTATGCGTTATTATTTTTGTCCAATCAATGCAATCTTCATCAGGAATCATATAATCTTGGATTTTACCCAATCAATACAATTTTCCAGAAGTCA
GCCCAAAGATTTTGCCATCGATGGCCCGACTTCGTGTCGGGCTGCAAGCCAGCGACCAAGACGAGCCACGCCTCGTGTTGGTGGGGGCACCGTCTCGAAG
CCGACGAAGATTTGTCCAGTCTCGTGATTTATAGTCACATTCACGCGAGTGCAAGTTCTTCAAAAGAGTGATCCTGTTGTTCGAGAGAAAGTATCGTGGA
AAATCACTCTACAATTCTCTTAAAAGAGAAGAAAACCAAAAGATACTACAGAATGAATTTGGCTACTTTTGTAGATCTTCTTGTATCCTGGGGCCCTGGT
TGGTAGTGGATTAGTACCAATCTTTGCGGCAGTCGAGAGACGCTCCCCCTCCAAGTCCAGCTGTAATGCTACAATGCGCTTTATCCTGGTTGGGAGGTGG
TAGTTACCTGCACACTCGAGTAATTACAGGGGTAAGTATCACTACATTTTATCGCGTCGATTATCGTGTTATGTTTGCTATCAATAACGTATAGATACTG
GCACCTCGGTTTACTACAACTCAAGATGATATAGAGAAAGTTGCCACAGAATTTCAATCTCTCAGCAACGGTGGAGTTATTGATAAGTACATCGGCACCA
TTGAAGGCTGGCTTTGTCCAATAAAGGTTCCCAGGAAGAACGAGTGCGGACGAGTCATTTCGTTCTTTTCCGGTTACTATCAAAAGTATGGACTAAATGT
CCAAGCTTGCGCGGATCACCTCTCTCGATTTACGGCGTTTCCCATAAATTTGCCTGGGGGGATGAACAACGTTTACGCTTTTCAGCGTTGGAAGCTGGAT
GTACTTCTTCACGAAAGTTCTGGGCAGTTTTTCGTTATTGGCGACAATGCTTATGTCCAGAGCAAAAACTGTGATGACTCCTTATAATAAAGTGGAGTTG
TCGGATTGACCTGGCCGAGACGACTACAACTTTCACATTAGTCAACAACGGGTACGGATTGAAATGGCTTTTGGGTTACTCGTAAACAAGTGGAGAATAT
TCAAACGTCCTTTACGTGTTCGGTTACGACATTGCCGAATCGTCATATCTGACTCCATTCGATTACACAATTTCTGAATCAGCAAGCGTTCGAAGGAAGC
CGAGAAGTCTTCGAATCACATTCTGCAACTCTTACGTCGTGAAATGCGATCATGGAATAGGGATGAAGCTCTCGACTATAATGCAACTGCCCAGAGAAGT
CGTCCTAAAGCAACAGTACTTTCTCGTTGATATTATCTCGTAATCCAAAGTGAAACCGAAGAAATTCTAGTGAAATGTGTGAATTCCACAATGTTGTAGG
ATTCCCATAGTTATGGCTGCGTGAAGAGCTTGCAGAGCAAACATCTCCATTCACAAACGAAACCAAATCCGCGACGAATCGAGTCGTTCTCTTGTTGAAT
GTGTTTGTGGTGGGAGGTACCGCTTTAAATCACGACAAAAGGTACTTGCTTGTGTCAGTTCCAATGGACAAGCAGCATGACCGTAGCCCTCTCTGTGTCC
TCCCCACTACATTTAAGCCAGACCGATTTTGACCGTTTGGTTGATACTGTCTGGCGAGGTAGCTACTAAAACAAAAACGGCTGTAGCATACGAAAAACAA
ATGTCAGTGTAGTCATGGGCATATAATGCATGTTAGTATTTGTACCTCTTTGATCAGCGTTGTACACATTACTGATCCGTGTTCAATTATAGCAGCCCGC
ACTTTCCCAGCTCCCGCGTCCTCTGGTGTTGCTTGTCCTCTGGTGTTGCTTGTCCTTGACTCGTGCGAGTCCGAATTGACAGCTTGTGCCTACTCATGAA
CCGGCGCAGGACTCGCTCTTTCGTCAGCGGCCACTTCATGGGCTTCGAACTCCGGAATTTGAGATGTGACTGGGCAGCCATCTTTGCGCATCGAATTAAT
CCACACTCTTCAGCTCCACTCGAGAGAATTTCCGCTAGTCCACTAAACCGTAGATTCTTGAGATACCCCTCGGCGTCCTCACAAACCGATTAAATAAGCG
CTTCTTGCTTTCTTCACTTAGAAATCTGCTTTTTGCTTGCGCGTCATATGCCTACATGTGCAATCGGGGGTAGAAGTAAGAGATGGCTTCGCCCACAGAT
TGTCCAGCGGTCAGATGGTTTAATAGCTCCAGCTTGTGTGAGTAATCATCAGCAATCCGAGCGTAGCACTTCGGCTTTTTGCCGTTTCCTGTTGTACGAG
ATCGGCCCATTGCACTTTATTCAGGAATGACATTTGAGAAGGTTATAATTAGCTCCGAGATGTGATATTTATTTTTATCCATCGGTTAGGATAGAGTGTC
GTGATTGGTTATATTTAAATTTTGCTTAGGAGAAAACTTCGCTTAGGACAGGGGCGATGCGGTAGGGGACCCGTAAACCTACCTGGGGTCAGTACAAAGC
ATGGCAGTAACAAAAATCAGCAGCTATCAGGAATGGGTTGCCGCTGGAGTGGTGGTGGTAGCCCCAGTGGAGGACACACATTCGACCAGCTGATGATTGA
CAAGGTGCTGTCTCTGTTCCTACGCCATGTGTTACACCTTCACACGATTTACGCAGCTCTACAAGGAATTTGCATCGACTCTCGCATTCCTGATCGCCAG
CGATTCCACACGCATGACAAACTCTTGCCAAGTCCCACTATAACAAATACAATCTTCGGGAAGGGGGTATGCATATCGGAATCGCGTTAAAGGCCAACAC
TGCATCTACTTGGTCGAATCGAAGCCCGCGACCTACAACGAATATTCAGTTTTAGCTGGGACGGAAGCAGAGTGGAATGGCCGCTGTACGAGCGCGGAAA
CGCATCCCATTTAGGCAAAACCACACGAACAACAGAATAGAGTCTAAACAGGGCGAGATCGAATAGGGTCATTCCAGGTTGATTTTAGGCTTTCAGGCAG
TGCAGCAATGCGTATGTATTGAGTACGAATGTATTCAAGATTTACGGGAATACAGCCATAATGGGGGAGCTCACCTCCTTTAAGTTCAATTCATCCTGAG
CTTCTGTTCCACACGAACAGATATTTTGAGGTAGCTACCTCCACCCGTGTCCTATAGGTCCGAGCACAGCACCAACGACGTCAAGTACGACTACGCCAAC
AGTTTCGATACGAGTACGCGATGTACTCATAGTCCTGGATCGGGCGTTTAGAGTATTCTGCGTCCTCTAACTACCACACCTGTCCCAATACGCCCGACTA
CAACATTGTCGACGTCAAGTTCCGTTACTCCTACAACTTCGAATACAAGCGCGAGACGTACGCATATTCGATGATAGGATGCTTTGGGCACGCAGCGTCC
TCAAAGAATGGTACTGGGCTCAACTCTGATGATCCAGTTCCACTGGCTACGTATAGAACTATGACTGACCCGCCCACCCCAGATGAGTTCCAACTTCGAT
CACTGTTTGACGCAGTGTCGATACTATATATCCAACGTCAAATGCATCATCAAATAGATTTCCACAGCAGGTTTATTGGTTCAATCGGGGTGATGTAACA
CCTTCTGACTCAAGATCAGAACCAGAGCAGCATTACCAACGCCTCAGTGAGAGCGTGCAGGGGACACACCAAGAACTCGTCCTTAGGGTGATACCCTGCT
CAGCAGACGTCTTGACGCACAGGAGCCAAAGGTAGAAGATGTCATCCGCAGATACCGACACTTGCTACTTTGAAAGTCCATGCTAACATGCTCCTTCTCC
AACATCCTCTTGAATGTGGCAATCGCGGTGACGCACGCCTTCTGAGTGCTACTAGGAACGAAAGTGGTTTGACGCATCAGATCCCTCTACTTCTCTTACT
TGTTTGAGTAATGGGGAGCTGCCTATCAATATCATGTAAACTGTCTCCCTACTCTAGGAAATGCCTTGCTGTCTAAACTGCACCATTATTTGAGAAAGTC
TTTTCAGATTTGAATGTGTATCGACATATTCATACTTTCACGGGTTCCCGGCAAATATGTGTTAAAACGTGTCAAAGCGCAATGCCCAAAACTATAAGGA
ATGTAATTGGTCAAAATATATATTTTCATACATACCATTGGATAATAGTTAGTCTCATTGTACTACCAAACAACCATTTGTCAAAAGACTACTATATTCA
ACTTTATTATTGATAAGCCCCGAATTGTAATGCTTAGTACGGAGGATAAACAAAGTAACGGTGGTACAACTTTTTTCTATTTTCCAACCTCTGGTAGTAT
TTGTGTCGCCTATAATTCAGAGCTTCTTCAGGTCAGAGGCCTATAATACACTGCTTATTTTGTATTTCTTGAAATACCTTGACTTGTATACAGATGAAGC
TGCTACTCTTTGGCGAGGTATACCCCGCTACAGTAGTATTATGTTACTATTAGGCTACAGTCGCAAAAGTGAGATTTTCACTAATTATGGATGTGTAACT
TGGATATCTGTGATATATACGGTACAACACTAAATGCAGTAAACAATTGCGTTTTCGCGATAAAAGCGCATAACAAGTCTAAGCCGCGCTATATTCGGAT
CTAATTGTGTCATTTTGAATGCAACTGATTCGCAGCTGAAATACTCAGATATTCATAATAATATCGTATTTATCGATAAGACATTGAATTGCGTATAAAA
CTAACATTTCGCATAGCCTAGTATGAACACCAGTTTAACTCCGCTGTACACTGCAGACACTGGCTCATACTTCATCCAATAGCTACAAATGCTTCAGAGG
GTAGTGTGGTGGAGTGGGATTCGCAAAATCGCGTTGCGATCCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN