Description :
From Genome Similarity Track
Location :
Scaffold_10:87613- 89988
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_10-snap-gene-0.40Anoctamin

Sequence
2375 bases(100 bases per row)
GACGACGATGATGAGGAGGACGAGGACGATGGCGACCACAGTACAGCGAACAATCCGCGACCCGTGCGACGAGGGAAGCGCATCCGACTGCAACGCTTCG
TGCCAGCACAGGAGCTCGTGGCGGAGGCCGACGCCGCGCTGTACATCGAGCTGACAGACCCAGCAGAAGACGACGACGATGCCTTTCCGGCGACCTCCAG
CGAGTTGGAGCCGTACGAAGACGCTGAGCTGAAGCGGCTGAAGAGACAGAGAGAGGCAGCCTCGCGTCGCGAAGGCGCTATCGAGGCCGCGCACACCGCC
GTGCAGTTAACGGCCGTGCTGCTGCGCGAGGCTGGCTGCAACGTTGTGGTGTACCCGCTGCAGGAGCGAGATTCGGACCAGGTGGCGCATACTCGCGAAG
ACACGAGCGCCTACGTGTTGACGGTGGCTGCGGGTATCAACGACGAAGGCCACCACCGTCGAGTCAAGGCGACTCCGCTGGCCGAGTGGGTCTGGCGCCA
CCCGGCGTTCCATCAGCGTGTGCTGCCGCTGCAAGGCGCGGCGCAGAGCCAACAGCTCGTGCGCCTCATCCTGACCGAGTTCCGGGTCGAGCGAGATCTG
TGTCTGACGAGTGGACTGCGGGTGCTGCGAGGCGGCCAGAAACTGATCGATCAATTAGGGGAGCGAGATGACATGCACGTGCAGATCGTGCCGCTTCACC
GCGACGACGCGCGGCGCAAGCTCGTGGCCAAGTGGCGCGCACACCCGACGCTCGCACTGCCGCTTCGCGACGTGTACGCCTACTTTGGTCCGAAGCTCGG
CATGTACTTTGCGTGGCTCACATTTTACACCAAGATGCTGCTGCTACCGAGCGCCTGTGGGCTTGTGGCGTTCGTGCTTGCGCAGCTGAACGTGCAGAGC
TACGGTGTCTACAGCTTTGGGCTGGCAATCGGCACGTCCGTGTTCGTGGACATGTGGCGCCGCCGCCAGCGCGAGCTCGAGTACTTGTGGAAGTACCAGA
CGAACGACCGGAATGTGCCTGTCACTGCCACGACCGATATCCCAACGCCAGAGAGCGATACTTGTGCATTCCCTCCCTGCGCTCCAAGCGTCGAGTACAT
CGAGACCCGACCCGAGTTTCGAGGCGAGTGGATGCGCGATCCTGTGACGCAGCAAGAGATCTTCGACTTTCCACATCACAAGCGTCTCTTTCGGCAGCTG
TTGGCGCTGCCGCTGCTGCTCTCCATGTGCTGCGTCGTCGGCGCGTACGTCGTGGGACTCAACATGCTCTCGGATATGCTGCGTGCGACCTACGGCGCGT
GCTACGCCAAGCCTGCAACCCGCGGCACGGCACTAGTGGCGCTCAACGATGCTCTGGACCTGACTCCGACGATGTGTAATGTCATTTCGCACGGTCCCGG
CATGCTCAACGCGCTCATCATCTACCTCATGGACTTGCTCTATCAGCTTCTCGCTCGCAAGCTGAACGACTTTGAGAACTATCGCACGGACGCCGAGTAC
GAGGATCATCTGGTGATGAAGCGAATGCCGTTTCACTTTGTCAACTCCAACGCGTCGCTCTGGTTCCTCGCATTCTATGTGCAGTCTCTGGAGCGCGTGC
GCGACCGACTGTGGATCCTGCTCGTGGCCACCCAAGTGCTCGACAACCTGAAGGAGGTCGCGCTGCCGTACGTCGTTTCGGTCGCCGGTCAGCTCCGAGC
TTACACTGTGGCAGCGGACTCGAGACAGCGCCGTCGGCACCGGACTGACTCGTATGACGATCACTCAGGCTCAGACTCGCACGACAAGGGTCTGCGACGA
CGCAAGAGCGTGTCGGAGACGGCTGTGCAGGACCGGATTGCTCGTGTCCTGCTGCAGCGCCGACAGGCACAGTACGGAGACACGTTCGCCGACTACAAGG
AGCTCATGGTGCAGTACGGTTATGTGGCGCTGTACAGTCCAATCTTCCCGCTCGCACCAGCGTTTGCGCTGATCAACAATGTGATCGAGAGTCGCTCGGA
CTTTCTCAAGCTCGTCAATCGCCGCGGGTACCAGCGTCCGCGAGTGCAGCACTCGCAGGGCATCGGTGTGTGGGAGAAGGTGCTTGTGAGCTCGTCAGTC
GTCGCTGTCGTCGTCAACTGCGCGCTCGTGTGGACCTACGAGCTGCACGAGCTGCTTCCCACGTGGTCCGAGCTGCATCGGTTCATGTTCATTGTGGTGC
GTTCAGTCTCGTTTGTGTAGTTGACATGAGTTTGTATTGACCTCTTGTTTGTGTGCTTTGACAGGGCTGCGAACACTTGATCTTTCTCATCAAGGCGGGA
CTGAACTGGGCATCGCCTGACCTGCCGGTCTGGATCCAGAACGAGCAGCGCATCGCTGCGCTCCACGAGTCGCAC