Description :
From Genome Similarity Track
Location :
Scaffold_1669:876- 2009
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1669-snap-gene-0.1Taurine dioxygenase

Sequence
1133 bases(100 bases per row)
ATCAAGAATGCCTACAACCTCGAGGTCACCCACGCGACCTTTGATCGCCCCGAGTTCCGCCAGGTCTTCCCCACCGAGACGTACCCGCCGATCCCCGTGC
TGGATTTTGATGACCGCGCGGCGTACGCCGACCCGACGCTCAAGNNNNNNNNNNAGTGGACCAGCAGATCACACCATCGCAGCAGCTCGAGTTGGGGCGG
TACTGGGNNNNNNNNNNCTACTCGAGCATGCGACTGTCCGCCACATCGCGCCCAAGATCGGCACGGAGCTCTCCGGCATTCAGCTCCACGAACTCACGGA
CGCGCAGAAAGACGAGCTCGCGTTGTTAACGGCCCAGCGCGGTGTCGTGTTTCTCGTGGACCAGCAGATCACACCAACGCAGCAGCTCGAGTTGGGACGG
TACTGGGGCCCCCTCCACGTCCACGCGATGCTGGGCCACGTGCAGGGCGAACCGGAGCTCTTCGTCGTCGAAGCGACCGTCGAGACCAGCGAACAGATTC
TCCACGCGCAAAGTGAGCTCGTCAGCGAGTGGCACAGTGACGTCACATACGAGCGACAGCCACCGTCGTACACGACGCTGAGAGCCCATGCTGCACCTGA
TGTTGGTGCGGACACGATCTGGGCGTCCAGCTACGAGGCGTACGATCGTCTTACGCCGGCGTTCCAGCAATTTGTCGAAGGACTNNNNNNNNNNATACAC
GACGCTGCGAGCCCATGCTGCACCTGACGTTGGTGCTGACACGATCTGGGCGTCCAGCTNNNNNNNNNNCCCAGGCCGAGACGGCGATCGCGAACGGCAA
GACACTACGGCGGCCGATCGTCGAGTTCGAGCACCCCGTGGTGCGCACGCACCCAGTGACCAAGCGCAAGGCCCTGTTCGTGAACCCGCTCTTTACGACC
CGCATCAAGAACCTCTCGCGCGCCGAGTCGGACGCCGTGCTACGGTTCCTGAATACGCACATTGTGCAGGGCCACGAGTTCCAAGTGCGGTACCACCTGG
CCAAGAACATGGTCGCGCTCTGGGACAACCGCATTTCGACCCACGCCGCGACGTTCGACTTTCTGCCGGGAAACCGCTTGGCCACGCGTGTGACCACGCA
CGGGGAGATCCCATACTTTGACAAGGGCGATGC