Description :
From Genome Similarity Track
Location :
Scaffold_761:876- 1917
Sequence
1041 bases(100 bases per row)
GACTACACTAGACTCATCTAGCTGGTTAGTCCTTGGTGACGCTTGACTCACTGTCGATGCACCCTTGACTAAATTAAACACAGCATCATTTACGTTATCC
TCTCTCAAGCGCACATCCTTTCCGGTGTCTTGCGTAGAGCTAGCGACTGTGCTTGTTCGTCAGTCTATCCACTGTTGATGTTTTAACCAACCAGGCATAC
TTAGGATGAGGTCATACGGACTATCTATGCCTAGCACTGTGAACTTCTCTTTGCACGAGAAGTCACTGAAACCGAAGGCAAGTTCGACGTGAACTCTCTC
TAATGTCACAAGCGTACTGTCTGCTAAGCGAACGGTCGCTTCTATACGCTTGCTATCTCGGCAAAGCGCCTCATAAATCGCCGGACTCTTTTTCAGAGCC
GCGAGATTTGCAACGTTCTGTGACGCATCCGAATCTACGAGAAGGGTCATCACCTGGTCCTAGTCGCGCACTCGAGCGCAATAAACCAGCATGTTTGATG
ACCATTTGCCTGGTACCTCGGGGACCATACTACCCATTTGTTTAACAACTCTAAACGTCGGGGTAGTTTCAGTCCGCGTCAGTACGGCATCCCGCCCCCA
CCGCGCTACTGCGTTCCTGACCCATGCTTGGTCGATGTGGAATCCGAGCGTCTTGAACGCTGGTTCTTCACACCAACCTTTGGGTTGATAATTTTCATGC
CAGGCGCTTTCGCGCTAACGCCACTTTTGCATATCAGCGAGCCATCATATGGTCGCGCACTTGTAGTTGACAACATCTGCGTTGTCCAACTCCATTGTAG
TGGCGTCAGACCTTTCGTTTGCCGGCTTTTGCTAAGGCGTTACCGAAGCAATTGCTCATCAACTAAAGCAATCTCAATTGCTTCTTTCATTTTGACGGCA
CCTTTCTGAAAAGGTCCTGTCGCGCTGGACCATGCCGCAGTCAATTTTGGAACGTGGGTACCTTAATGTGTTTCGGTATCGGACCCGAATCTCCTGCACA
TAGTCTTGCAGGGATCGCTGTGCTTTCGCGAGCTAAAGAAG