Description :
From Genome Similarity Track
Location :
Scaffold_174:87592- 88714
Transcript NameFunction/comments
g7774.t1ETI47354.1 WEE protein kinase [Phytophthora parasitica P1569

Sequence
1122 bases(100 bases per row)
ACTTGGTTTTAGCGGAAGGGCAGCACCACCTCATGCTGCAGGATGTCTTCGGCGAGAGGCCGCTGCAACGCGTCTGGGTGTAGCATGCTGGCGATCAGGT
GCTGCAGCGAGTTGGAGTATTGTCTGCAGTGAACAAGTGAGCAAGCTTGTCAGCAAAAGAAACGAGGCCGCGGGGTGGCAACAGAGTATCACGTTCGTAC
CGGAACATCACGAGGTCTCCGTCGCGGATCTTCTGCCATTCTTCGCCGCCACTCGCCAGCGTCGTTCCAAGCGCGAGCTCATAGATTGTGGCCCCCAGCG
CGAAGATGTCGCCGGCGCGCAAGTTATTCCGGTTGCCTTCTAGCAATTCGCTGCAACGAACAAGGAAGTGACACGTTAGTTAAACAGCCCCTTGCCTCGG
CAAGTAGCTAGGGTAGAAAGCACGTACCGACTAAGATACCGATTGTCGCCCTCTGTGATCTCCATGCTGCCGTCAAGGTGAGCGACGGTTCCCAGGTCAC
CCAACTGCACGCATCAAATGTGAGCTCCAAAACCTAGACATTTCGGCAGCATCCGAGAGCAGCTTACCTTGTAAACCTCTTCCGGGCCGACCAGCACATT
TTGTAGCTTGACGTCCATATGGACCATTTTCTTGCTGTGCATGTCGTAAAGAGCCTACATAAATCAAAGACATTGTTAGTTCCGGTCAAAGAACAGGAAT
CTAGAAGACAAAAAGATCTACCTGAGCAATATGGCACAGCAGCTTGCACAGCGTCTCTTCCGGGATCTTGTGCGGTGCGTACTTATTGGCAAAGCCAGCC
AACGAGCACCCCTCCAGGTTTTCAAGCTGGATGTAGAGCAAATCGTCTTCTATCCAGGCGTCGAAATAGCGGACAACGTGGTTGCTGCTACTCAGCGCTG
CCAGCGCCTGCACTTCTCGAAGAGCTCGCTCGCTGTGGTGCAAGCACAACAACAAACGTAAGTGCCTATTTACGCAAAGCACCAGCAAACAATGCACAGC
TCTGCGTACGTGTCTGCCTTCCCGCGAAAATGGCGCTTGCTCTTTTTCACCGCGTACACCCAGCCATCAATCTTTTTCATGCACTTGTACACTTTCGAGA
ACGAGCCCGAGCCGATTAACTG