Description :
From Genome Similarity Track
Location :
Scaffold_121:87590- 88824
Sequence
1234 bases(100 bases per row)
TGCTTTCTCCTGGGCGAACTGAACTTTCAGCGACTTCTTTGCTTTCGTCGGAAACATTCGTGGTCTCTCACCTCGAAAGAGTGTGACCCACCGGTGTTTA
GGTGCGCGTAGTGACCATCCCACTGAACTACCCTATTCTTGAAATCGAGCACTATGCCCAATGAAGTCATGATATCACGACCAATCACTATAGCATATTG
GCTCTTTTCCAAAATTTCGAACCTGTGGGTGATTATGGATGAAGGCTAGAGGGATGCAAATTGGAACTGAATAATTGCACTACCATCACTCGTCACCTCG
CTATTAACCGTCTGTAACTTGGTAGTCGAAGCGACTTGTTTACGCCCGAGCTGAACATTGGCCCGCATAGTCTTCTGGTTGATGATGCTCAACGACGCAC
CGCTGTCTAGTAGCGCATCAAAGATGCCGTTCGCGTTCTTGAACTGAACCTTGATGCGTAACGGAGCGAGCTTGGTGCTGGTTTTTTTCTTGGCGGCCAG
ACCTACGCGCTTAACCTCTCTGTCGCTCTCGCTTTGTCTTCTTCGTATCTGGGATAATTGTTCTTGCTTGAGGCTGTTGCCTTTGTCTCGGCAGGTTTGT
GCTCCTCGCGCTGCTTCTTGAGAGAGAAGCACTCACTGGAGTTGTGAGACTTTGTTTGTGAAACGTATATACCATTATCATGGTGGCGCTCGCTTTTCTT
TTTGTCGTCTGGGACACTCCGTCGGTGATGACGATGCTCATGTGAGTCTAGACGTTCGCGATGGTTGCGCCGATATCTGCGGTCATTGCGATCATTGCGA
TCATCGAACGGGCGTTACTGGTCGCGCCGACCTTGACTCCTTTCACCGTGCCCCCCTTGACCATTTTGGCGTTCACGGCCATTCTGTTTTTCGCACCTTT
CGCACCATAGTTCGGTTATGGTCTCGTAGGAAATTTCACAAAATCGAGTTTGTCTTGCCAGTTCAGAGGCATAACTCGGCGAAAGCAGCGATATAGTTGA
ATCTTCAGGATGGTTCGCGCATCCTGGGTCAACTCGGCGTACATTTGTGCAAGTTCTGGCAGATGTGCCGAGCACCGTTGAACTGTTTTGTCGCGGCGCT
TGGTCAGTTTCCATAGCTCCTCGTCTAGATCTTCACTGTGGTCCGCTGGAACCAGAAGTAAGCCAAACTCAAGGTATAACTAGTCCTTTCTCAGAAGATT
CGCCGGCGATGCGCTCTACCTCGCGCGATATATC