Description :
From Genome Similarity Track
Location :
Scaffold_446:8758- 10098
Transcript NameFunction/comments
Phyra_86070protein phosphatase 2C, putative

Sequence
1340 bases(100 bases per row)
TCGCTATCGCTATCGTCCTCCGAGGACGACGAGAGGCTGAGCGAGATGGTGTTCGGAGCCTCTTCGTCGCTGTCGCTGGAGTCGCTGGAGCTGTCGCTCT
CGGCGGTGCCCTCGTCCGCCTTGTCGCCCTCGTCCAGCTTGCGCTTCTTGCGCAGACTCTCCACGTCGTCCACGACCTCGTCGTCGTACAAAGGCGCGCG
TTTCTCGGGCAGCTTGAACTTCTTGCGCAGGATCTCCATCGCGTCTGGAGGCAGCGGGTCGCCCGTTTTCCATGACTCGGGCAGTGTGATGCCGTGCTCC
GTGAAGAAGCTCCGGCCCATGTAGTGCAGCAGCGCGTCGAGCGGCAAGTCCACGGGGTCCCCTGGCTTCCATCCAGGTGGCATCTGCTTGCGGATCTGCG
CGTCGCTCGCACCCAACCCAATCGGAATGTTGAGCTTCTCGATAGCGTCGCTGCCCTCGCCTTCCTGCTTGACCCGCGCCGCAGTGGACGTGTACTTCTC
CGGGCCCTGCGTCACGATCTCCGCGACGATGCCACGGCTGAGCACACCCGCTCGCATCATGTGCTCCTGCGGCGCTGGCGGCATAAAGCCAAACATCGGG
AGCTACATGTATACAACAACCCGACAGAAAAGCGCATGAGCAAGGTCAACCCCCCTCGCCACCTTCAAAACTCCACGAAAACGTACGCCAGGCTGCCACT
CTTTCGGTGCCGACGTCGTGCCGGCAATGCGGTGTGCATATGCAACGATATCGCGAGGGTCCAGCACCACTAGAACCACAAAAACCACCGTTAATCCACT
GCTAAAACAACAAGAAGAAAGCCAAGTGGCACCTTTGGACTGGTGCTTGGCGTTCTGTAGCACCACTCGGTGCTTCCTCAGCACGTTCGCAATGTCCTCC
TGGGACCTTCTCAGCTGTGCCGCGTACTGCACGACCTTGTGCTTCTTGCTCTCGATCTCCGCCTCCACGCGCAGCAATTCCTTCTGCGCCAGCTGATGCC
TGGCCACTAAAACAACGACGTGAGTCTCTAAATCGTCTCCTCTGCTGCCTAGTTCCTCGCCAACTCACGCTTCTTCACGGCCAACAGCAGCTCACGGTCC
TTCTCCAGCACCTTGTGGAACGTCTCGTTCACTGTGCGCAGCCTCGTGGCCGTGATCGTGGACGGCGGGCTGCAGGTTTAAGCATCATTTGAAGCGTCCA
GAACGTGAGAATTACGCCGTAAAAACGTGTGCAAACGGTAGTTGGATACATACAGAGACGCCGTGTTGAGCGACTCCAGCAGCTTGGTCACCAGGAAGCG
GTGCTCGTGCAGCGCCACCTCCACCTCCTCGCGGATGCTC