Description :
From Genome Similarity Track
Location :
Scaffold_78:87579- 95521
Transcript NameFunction/comments
Physo_139753hypothetical protein
Physo_139754hypothetical protein

Sequence
7942 bases(100 bases per row)
CCGCTCTGGTGAGGGGACAGAAAGCGTTCGACCTTCGGGGAGATGCGCTCGAGAACGACGAGCGAGATGGCCTTGCGAATGCTGTTGAGCAGCACAATTG
GTCGAAGGCTGGCACATTGACCAGCCGGCTTGTTTGGCTTTGGAAGTCCAAGGAGAATTCCGTCGCCCAGATGAATGTTTGCTCCAGTAGAGAATCCGTC
CTTGAGTATGGCAGCGAGAGGTTGAGCTAGTGTCGTAGATCCGTACTTGAGTAGCTCAGCTGGGATGGCGTCAGGTCCGGTTGCGCGGCCATTGCGAAGG
CGATGGAAGGCGCGTGCGAGCTCGTCGGCTGTAATGGGCCTCTCCAGAGGGCGAGCCACGCTGTCGCTGGGGACGGACTGTCGGCTCGGGTCGTAAAACT
GTTCCTTGAAGTGTTGTCGGATCTTGGCGCCTGCTGTTTTGCGGTGGAGAATGTATTTACCTGTGGAGTCACATAGAGACGTTAGTGGTGAGCGCTGTCG
AAGCAGCACTCGCGTTGCCTCGAACATCCTAGCCGAATGGCTAGAGCGGTCTATGGCGGTTAGTTTCTCGTCAATAAAAGTGCGAGCAAGGTGTCTGCTG
CTCTCCCAGATTTTGTGAAGTACGTGGTTGCGTCGGCGGCGGAGGTCATCGACGTCCAGCGCACGGTCGTTGTAGATGGCTAGACAGAGTCGTCGTTGTT
CGCAGGAGAGACGTGCTAGTTCTGGATCCGGCATTTTGGCGCTTTTGGCGAGTGGAAGGTATCCAATCGAGTCTGCTGCTGATTCCAGTGCTGTGTTCAG
CGTCGTCGCCCAGCGCTGGTTTGGCGATCCCCCCTGGTGTGGCATGGCGGTAGCTGGCGGTATTGTAGTCGGGAGCGTTGGTCGTGCACTAGGAGGTGCG
TGGCGAGGCGAGTCTCGGCGTTGTTGAATTGGACTCTGGCAACTCGACGCTGGAGCCCACCGAGTGCGCGGAGATCAAAGTCCAGCGTGACCAGCTTGTG
GTCGGTCGGTGTGAGGATACCGCCCCACGACTGTGCGTTGATACACAGGGATTTATTCCACTGGCTGCAAATGATGTAGTCGATTTGGTTGAAGATGCTG
TGTTCCTTGAGTCGGAGCGTCCACGTCGTGATGTTGCAAGCGCGCTTTCGGAAAGCAGTGTTAGAAATAAACAAATCATTGGCGTCACAAAAGGAGGCGA
GTACGTGGTCGTTGCGGTTGCGTCGGCCACGTCCCCATTGTCCTAAGAAGGGTTCGTGTTCGCGTTGCTGTCCAATTTTTGCGTTGAAGTCGCCCAGTAT
AAATGTCGTATCGCGCTGTGGGAGTTTGGTTAGCATTGCATGAAGATCCTCGTAGAAACGGTCGACCTCGATAGAGGTGTAGCCACTGTGCGGTGAGTAC
ACATTGATGATGTTCACTCGCTGGGCCTTGGGCATGCGTAGTTGGAGGACTCCAACACGGTCCGAATGGGCCCAGTACTTATACAGGACCTTACGCAGGT
GAGGTGCAATAGCAAAACCAACGCCATGCCATCGCTGGGATGTCGGTAGAGTCAGGAGATGGTACTTACCGGACTTCTGCTCACTTTGATAGGGTATGCG
GGTTTCTTGGAGGCCTAACACGTCGACGCGGTAGGCCGACAGGTCTCGAGGGAGCGTCTCTTGTTGCTTGCGCTGGGAGCCAATGGATTGCACGTTTAAC
GTACCTAGCCGGAGATGGCGAGCGGGCTTCCGCGGGCGGCGCCGTGGCTGCGTTGCTGGGAGCTGGGGGTGAGAGGGGTGGTTAGAGAGAGATGTGGAGA
GGGAGAGACCCGTCAAAGACTGACAGACGCCGTGAAGCGTCTGCTGGAAGCGTTGGGCGAGCAGCATGCTTGCCCAGGCTTCCCGGGAGGGCGTCACCCC
AACCCGACCAGGATATTACTATGGTAATTCAGAAGAAAATCGTGTTACTGAAAATCGTGTTACTGTCAAAAAGTTTTTTTTAGAGATGTCACACAGTGTG
ACATCTCTAAAAAAAACTTTTTTTGCTTACCGGTGTTGGAGTTGTGTACGAATCGTGTGTCAGGACCGGTGTTGCAGCTCTACGCCAACCGTACTGGTCC
ATCTGCCATCCGCGCCATCTCCGCGTCAGTCTCCTGCGTCCCCCACGGCCGCGCTGACGCTCGCTCTCCCCGTCCTACCTGCGCCTGCGTGTCCTCCATG
TGGCTCAACAGTCGCGATCTCTCGGCGGACGACGACGGCGCCAGCACGCGCGATGGCGTGTGGGGCTTCGCCGCGTCCAACCAGTCGGCGGCGTCGCACG
GCACCATCGGCGCCTCGGGCTCGCGCGCGCTCTGGAACCGCATGGAGCCGGCCGAGGAGGAGCGAGAGGAGGAAGCCCTACCGTCCTACCTGTCCTACCT
GCAGCCGGCGTTCCGTCCGGCGCCTGCGACGCCCACTACGTTGGCTCCGAGTGCGTCTCAGCAGCCCCCAGCGTTCTACACGGCCAAGCGCGCCGCCCCG
GGGCTGCCCACGCCCCCCACGCCAATGCCGCAGCCAGTGCGAGTCACCCCCGAGGTGGGGAACGTCGCGCGCAAGAGCTCGGAGCTCGCGCAGGCGCTGG
AGCACCTGGTGCTTGGCTCGGTGCAGCGACACTTGGGGGACGCCACGCCCGACAAGACTCAGGTCAGATGCAGGTGCGCGTGCGACTCCATGCGGGCGCA
GATGAACGAGATGGTTCTGCAGATGCAGTCGCTGCAGAACCAGGTGCTGGAGCTGACCAAGAACTCGATCCCCACGGCCATCGAGGTCGGACGCGTGAAC
GTCAAGGCCAGCTCGCCTAGCAACGGCAACTGGAGCGCCAACGCGGCGCCTTTTGTGCCCAAACAGCAGCAGCATTACAAGCAGCAGACGCAGCCCCCTC
CTCCCCCGCCTCCGCCTGCTTCGGCAGTGGACCAAGCCACGGCGACGGTGCTGAGTGACCGCATTTCGACGCTGGAGGGACGACAGAGCGCGTTCCAGTC
GCAGCTCGCGCAGATCGCCAAGGTGTTGGGCATTCCCACGGGTAAGCCTGGTAAGCACAGCCCTGTGAAACATTTGGTGCAGACGCTGCGCGACGAAGTG
GACGCCAAGGTGCAGCAGGCGACGGCGGAGGCGCGCACGGACCTGACGGCGGAGATCAACGCGGCGCTGGGAGGCATTGTAGCGGGCAAGCCGGCAGGTG
GCGACTCGCAGGACGCGCTGTCTTCCAATGCTGTGCTGGCGGCGCTGGCGGGTGAGCACGAGGCTTCGTTGGCGCGGTTGAGCGGGTCTTTCGAGGAGCT
GCTGGCGGAGGAAGCCCGCCAGCGTGCGGCGCTTGAGGCGCGTGTGCGCTCGCAGCTTGCTCAACAGGAGGAGTGGTTGCAGCAGTTGGAGGGGGCGTTT
GGGTCTCCTCATGACCCGGAGCACGAGCAGGAACCTCGTAGCAAAGACCCCAACTCGCAGCGCAGCGTGGACGCGAAGCTGGCACAACTCGAACGCAAGT
GCGACGAGAGCCGCGAACTCTGTCGACGTCTGTCGAGGTTACTACCCGAAGCAGCCAATTCACGGCTTCGGATGCGGCAAGGCTACGAAGAGGAGGACGA
AGAGGACGGACAGAGCTGGCCAGGACACTTGGTAGGCAGGGATAGGTACGACTCGAGCAAATGACACACTGTATTCTGCATTGTACGTTGCGGTTTTTGT
CTGCTTTATATCCTTCATGATGCTGGAGCAGCGGTTTGTTGCTGAAGCTGGAGGCCCTTCATCTGCACGAGGCTGGACGCTGTGCGGGCAAGGTTCTGGA
GGGTCGAGTACTGCGAGCGCGTGAGTTCGGCGTGAGGTTTGTCGTCGATGCAGCACAGCGTGCCCACTGCGACTTGTTCGTTGGAAGACTCAACAAGCGG
CGCGGTGACCGGGAAGCCGACGTAGCTGCGGAGAGACATCAGCTTGATCGTCTCGATAGCTTGAAGACGCACGTCGGCTTCGGGGTGGATCAAGACCAGC
GGATCTTGGGACATTAGCTGGTGCTGGCACATGGTGTAGTCGCGCGGCACAGCAGCCCCCTTGAAGTTGACGTTGGTCGACGCCAGAACGTGTTCGTGGC
TCGCCCCCATGACCGAAATCATCGCGTTCGAGCAGCCCAAGGTCTTCGCAGCTAGCTGGCAGATGAGCTCCAAGTCGCGAACATCGATTTGGGGTTCTAG
CGGGGAGTCGCGAGGCTGAGCTGGTGCCAACTGGTCCGCAAGCTTGAGCAAGCCAGAGGCTTTCGCGGCTGACAGGCGTCGACCCTCGTTGCTTGGTATC
GGGCCGCGCGGGACCGTTTTCTCGGGATCGTCGGGCAAGTCCAGCACGTAGCTGCGTCGTTCGGCGTTGCCTAGTGTACAGGCTTTGAGCAGCGGAAACT
TGCTTTTGTCTCTCAAGAACTCGCCGACCTTGGCAACGGCGTCAGCGTTACACTTGTTTTCAAGGTAAGCCATGTCGTCGTCGCCCTCGCCACTGTCCTC
TTCGTCCGAGTTTTGATCTTGATCCAGCAGGGTGCGGACTATGGCGAATACGTTGGAACGCTCTGCGCTACCAGGCCGGGCTTGGTTGAGAGACTCGGAC
AGGAAGTCGACCAAGAGTGAAGTTGTACTGCTCTCTGGAGAGTCTTCAACGACGCGAGCTGGGCCGTGGTTTCGGTCGGTGGAGATGTCGGAATAGTCAC
ACGCGTCCACGCAAGCTTGACATCTTCTGCAGACAATGATGGCAGCTACGCGTCCAGAGAGACTCTCCATGCGCTCGGGACTCCAGCAGTCGATGCAGAC
GAGATAGCCGCACAGGTAGCAGCGTCTGGTGTCCGTCTTCAGCGCCGACAAGCTCCGTTTCGAAATGGCTGAGGCCGCTACGGACAGCGAAAGCTTCACG
GGCGACAAGCTGCGCGTGCAGCATGGACAACGAGGATTGGCGACTTCGATGGCGTCGAGGTCGGCCGGAATCTGGAAGCCAAAGCGACGGTGGCGTACGA
GCTCCGAGAGCTTCGTCACTCCTCGAGCCAAAGCTTCAAGCCGTCGGGCTTGTGCCTTGATCTCAGCACTCTTGTCTGCTGTTGGTGAGCTGAGACTTTC
AGTGGGGTTGGTGGATTGATTCGAGGTGCTCCGATCTCTGTCATGCGACTCTGCCAAGAACTTAGCGTTGTAGACAACGCGCAGCCCTTTGCCTCTGGGG
TCCAGATCGACCAGGAAGACAGCGGTGAGGTCATGCAGTTGATCTACTCGAGTGTGCGTCCCCGTCATACGCCCCGGAGTCGGCTCATTCCGCCCTAGAG
AGTTCTGCGAGATTGTGAATCCGTCGCGTTCGCGCTTGCGCTGGAAGAAGTCGGTGTAGCACCACTGCTCGTTGGGACCGAAGAGAGAGGAGTTGGCAAA
GCTGCTCGTCTTGACTACAAGCTGCTCGCCGTCATCTTCAGTGGAGACATCAACAACGCGCTCGACCGATCCACATAGAAAGCGTTTGGCGTATAACGCC
GTCATGACTGCACTGTGTTCAGCTTCAGTTCGTGGGCACAAGATGCGCAGGACCTCCTCGATGCAAGCGTCAAGGCGGCCGGCACAAAACACTTGAGGCG
CTGTCTCGATCCTGCTCTTGACAAAGATCCCCACTTGGGCGTCTTGGTGACGGAAAACCACGAATCGATTGGCAGCCTCTACGCGTTTCCAGGGCCCACC
GGCATTCGGTCCAGCAGCTAACGCCTTGAAGTCGACGTGGTTATGAGCCTCTCGTGCTCTTCTCAACATCTCCGTGTCTGGAAGAGGCTTGCTGTAGCTT
CGACCACGGTCATTAACGTCCGAAGCTTCACTCGGTTGTGCCCCTGTCGAGAACGTCGAGCTGGACTCGGCGCTCTCCGAGCCATCACTGCGATGAGCAC
TTGAACTCGACCACGGGTAGCTGGGACGCCGTCTTCCCACCTGGTCAAGCATTCCTCGCACCATCGAAAGGTTCATCTCGACGCCGACACCTCCGATACT
AGGCGTTTGTGCCCCCTCGCGTGGAACTTGAATCGTCGGAAGTGCTCGGTAGGTGGGCGGAGACTTCTGTAGTGAACACTGGGACCAAGGATCGCTGAGC
GACTCTTTCTAACAAGTCGCAGACGGGTGAAAACTATCCAGCACCACCAAAGCCTTCGCTGGACTTGGATGCGGATTCTGTGTATTCATCGAAAGCGATA
CAGTTGCGCTTCTGGACGTAAATCATGGTCATGCAGCGCCCTGTGCGAGTTGCTGTTGAAGTTGTCGGCCTTTCAGCTGGATGAGCCTGGACGCGGTCTC
CGTGAGTCGCTTCATGGTGGCGTATTGCGAGCGCGTGAGCTCGGCGCGCGCGATCGAGTGGATGCAGCACAACGTTCCCACAGGCATCTCCGTCTCGGAG
TATCCGGTGGTCTCTGCTATTGGCACCAAGAGCGGGAAGCCGACGTAGTAACGGATCGACAGCGCCTTGACCCCCACGATCTCGTGGAAGCGGACGTCCG
CCTCTGGATGCGTTGCTACAAAGGGCTTCGTCGTCATGATGGTGTGCTGGCAGAAGCCCTGCTCTCGCGGGACGGCGGCATGGAGGAACATAGGGTTCGT
AGCCGCTAATACGTGGTTGTGCTTGAGCCCCGCGACCGACATGAACGCGTCGGTGCATCCCGTAGCACGCATTGCGAGCTGGCACAACAGATCGAGGTCG
CGGACGTCGCACGCGTCGTCAATGGATATCCCGGGGGCGGGATCCAGCGGCGCGTGCTGGTAGGCGAGAAGCAGCAAGCCTTTGTCGGTAACCACTCGAA
GGCGGATGTCGTCGTGGCTCGGGATCACACCGGGCGGCACCGTCGTCGTCGGATCATCCGGGAGATCGATTAAATATGTTCGTCGCTCAGCGTTGGCGAT
CACGCAGGACTCGAGTTCGGGCAGTTGGCTCTCGTCGCCCAAGTATCGCTCGAGCTCCTCCACAGCCACGTTGTTGTCCTCGCCACAGTCGCTGTTGTAG
CTGCAGTCGTAGTCGCTGTCGTCGCTCTCGTCGTCTGTGGCTTCGCTCTGCCGGAGAAGCATTCGGACTACTGAAAGCACCGCAGCACGGTCAGCGCCGC
CGGGTGGGGCGTTCAACAGCGAGGCGGCGAGGAAGTCGGTGAGGAGCGGAGCGGGAGAGTCATTCGGTTCATCCGCGACGACCTTGACGGGTCCTCGGTG
GTTGCTGGTGTTGTCTGGGGCGCACACTTCCGAGTAATCGCAGGCTTTCACCGCGGCGTGGCACCGCGTACAGACCACAATGGCCGCCACACGACCGATG
GTGCTCTCCATGTACTCGGCGCTCCAGCAGTCGATACACACGAGATACCCGCACAGATAACATCGTCTGGTGTCCATCCTGAGAGACCGCAAGCTTCGCT
TGGTAATGGCTGACGCAGCTAATGACAGCGACATCTTGACGGGGGCTAAGCTGTGCGTGCAGCATGGGCAGCGTGTGTTACCCGCTTGAACGGCGTCGAA
GTCCATGGGTACTTGGAACCCAAAGCGGCGTCGGCGGATGAGATCGGGAAGTTTTGTCATGCCATGAGCTAGTGACAGTAGACGACGGAGCTGAGCTTTG
CTGTCTGTGGTGGTCTCACCGATGCTGCCATTGCTCGAAGTAGAAGACACTACGCTCAATCCAGACCTCCTTCGTCGACTGCTAGTACGACTGGACATGG
TGCTTGTACTTGACGCCTCAATACCCATTACAGGGTCCTCGAACCACGCGTTGTAGACTACACGCAGCCCCTTCCGATTCGGGAGCTGGTCGACCAGATA
CGACGCGTTGAGTCCGTGCAGCTGATCAACACGCATGTTGTTCCCCACCAGGCGCCCTGGAGTCCGCTCAAATGGAGGCAACGCGCGCTGGGAAATGGTG
AAGCCATCTCGCTCCTTCTTGCGCTGGAAGAAGTCGGAGAAG