Description :
From Genome Similarity Track
Location :
Scaffold_41:8757- 10256
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_41-snap-gene-0.35Human conserved protein (Gene) telomeric to alpha globin cluster (CGTHBA)

Sequence
1499 bases(100 bases per row)
ACTTATTACTCATTCATGGAGACAGCAGACAATGATATCCTGGTACGTGCTCAGCACGGTGCGCAATTCGCTGCGTGATACGTTCTCGCGCCACATGATC
TCTTCAAGGTGGTACTGGCCGTGAAAATACACGCAGAGTCGCTTGAACAGCGTATACACCGGGTTGGTCGTCGCGATCTTGTCGAGGTAGTCGCGCTCCT
GATCTGTCAGCGCGAATGGATTACTGGCGCCCGTGACTGTCGTGGTCGTAGTCATCGCTGTGCTCGTCTTCGGTGGAGGCTTTGGCTTTGTTGCCGTCGA
TCGGGCCGATGACATGAACGACTGGAGTGAGAAATTCTCCAGCTGCTGCGGATCTGTTAGCGCGTGTGTGAGGCCGAGAAAGCTCGTGTTGTTGCGACTG
CGGCCGCTGCGACTGTTGGACCCGAACGAGTGGTTCTCGTCGTACGAGCTGTCCCCCTCAGGTTCCATGGCATCTGCGGCGTGGTCGCCCTCAGACGGGA
TCATGAAATACACGTACCGATGCAGCTGAATGATGAAATTCTGCTGCAGCAGCCAAATCAGCATGTGAATGTACTCGGTCTTGGCCTTCGGCGTCGAGAG
GCTCTTCATGTAGTCGCTGATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCCCGAAAAAGTCGAGAGCACTTCGCTGAGCTCATGTGGCGGGAACT
TGCGACGGAATGCGAGTGCAAGCGCCGACTGCGATCGAAGGTTGGCCTGCGGGTTGACCTGGTAAATATTGCGCAGCGTGATCGTGTCGATGACCTTACC
AAAGCCCCAGTAGACGAGGTGCGCCGAGAGCCGAAAGACGTGGTGGATCGGGATCGACGTCTCGAGCGCGATCTCCTGGAAGCTCTTGAGCGGATTCGCG
GCGTCGATGAGGATGCGCAACTGCTGAGAGTGATCCGCCGGCAGCGACGCGACGATCTTCTCCTCGTCCGCGAGCAGCAGCAGCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCCGCAGATTGTGCATCTGGACGGCGACCGAGTCCGTGAGCGTGAGTGAGAGCTTGACCCAGCGGTTGATGACCAC
GTGCACGGTGCCGGACTCATCGAGGCCGTGGAAGACGCTCTTGAGGTCGTTCGCGAGCACGCTTTTGCCCAGCGACACGTCGATGAACGTCTGCGGGTCG
ACTTCGACGCCTCCGGAACTCGTGTTCTCCGAGTTGGCTCCATCCTTGTTGCGATGATGGTTGCCGACGCTGCTGCTGTTGTTGTTGCCACTTCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAGGCGCTCGTTTTGCACGAGTTCATCGC
GAATGTGGAGCAGCTCGCGCACTTCTCTGGACACAAACCCCGAACGCAGCTCTTCATGCAGCAGCCCATTCGCAAGTTGCGCTGCGACGGTGCGAAACG