Description :
From Genome Similarity Track
Location :
Scaffold_7:87566- 88776
Sequence
1210 bases(100 bases per row)
GAGACATTGAATGTCTTGGTTAATGACGGGTCAAGCATAGGTAGCTATATGCTTGATCTGACCACGCCTCAGAAGTTGACTTCGGAGATCACTCAATTGC
CAACGCTAGAAACGAAACGGTGCTTGCGAGATCTCCGTAGTGGCAAGGTCAAGCAGATCTGTGTACTCGTCACGGAGGATGAGTACGTGACTGACATTCG
TTCGGCAGTAATATTTGCCTAGAAGAAACGGGTTCTCAGCAGCTCATCGATGGACGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGCGATACACGTCT
CAATCTTGGGAGTTGCTTCAGGCAAATCCTCTATACAAAGATTTGATCGATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGGATGA
AGGCACTCGTCATGAAATCGAGCTCAAACCGGGCTCAAGGTACTGTGTCATGAAGAAGTGGTCACTGCCTCGTGAAGAAGTACTTGCGATCGACAAGTTC
TTTGCCTATCACTTAGCATCAGGTTATGTGAGGGATTCAATCTCCCCACATTGCTCTCCGACCTTCTGTGTGCGCAAGGCCACGGGAGGATGGAGGATAT
TACATGCATACAATAAGTTGAATGCTGCAACGGTACCGGTGCAGACGCCGATACCGAGGAAGGACGTCATCATAGATGGTATGGCGAAAAGTACCATCTT
TTCGTCCATGGATATGAAGGATGGCTTCTATCATATACTTATGCGTGAACGAGACATCCCGTTCACAGCAGTGAGCACTCCAGCGGTATGCTCTGGGAAC
GGCTGGTTACGCCACAAGGGCTTAGTAATCCCCAGCCACATTCAACAGATGCGTCACAAATCTGTTGAGACCGGTGCGAGATTTCGCATCGAGTTACTTT
ACGGATGTATTCGTGCTATGGGAGGAAAGACGGACGTAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGTT