Description :
From Genome Similarity Track
Location :
Scaffold_172:87533- 89980
Transcript NameFunction/comments
g6227.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
GACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATT
CAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCCACAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTA
CGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCAAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGT
CATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTTGTAGTAAACCACACGATCATGACCTTCGTGATCGAGTTGCATCAGTGCGCATCC
GATCGCGAAATCGGATGCATCGCACACCACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCA
AAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCTTCTTTCTTCAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGC
ACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTTCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTAC
GCCGTTCTTTCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCA
AGCAACTTGCGGAGATGCTCTGTATGCATCTTCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGT
CGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCCCTGGGGCGTTCTTCAGCCCCTGTGGCATCACGAGCCACTCCCAGAGCATGCCGCT
CGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTC
ATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTATACACATGAACGATGCGCCACCCGCCCT
GTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTT
GACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTAGTGCTGAACACCCTTATCCTGCGGTAACTCC
GCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCT
TCTTTGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGAT
CTGCTCGATGCGTCCATAGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGC
CTCATCTTCTTGTATTGGAGACCAATACTTGTACGCATCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTT
GTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGCCCAGG
CCCGGCCATGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGC
CCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTAC
CTCTACGCCTAACGGCGGAGTGTCTTTTGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATC
GGATTGAACCAGGCCCTGCTGATTCGTTTCACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGC
GCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGTTGCTCCCGAAGCGCACGA
TCGTGCGCTTCATCCAGTCGATCACCGGATCATGCCGTGCAAGCCAC