Description :
From Genome Similarity Track
Location :
contig_129:8751- 15633
Transcript NameFunction/comments
g11552.t1hypothetical protein

Sequence
6882 bases(100 bases per row)
TTTCTAACGATACGCCAGCATCTTACGTGTTTCACACGGTCAAGCGGATGCAGGAGTGACTAAGGAGAAGCGCTTCAAGGAGCACAGGAGTAGTCTGAAG
CTAGCTGCACTTAGCGAGGCAGAAGAGCAGCAGCTGCGGACGGAGTGGAAGGATGAACCGGCACAGGGACTACTGGAGAGATACCAAGGACTGGTGAGCT
ACTGGGCTGAAGTCAGTGCGGAGCACAGGCAGAGGTTCAATTTTCTGATGAAGGAATGGGTGCTGCAGAAGGCGTTAACGCAAGCGGAAATGGAGAGGCG
GATCCAGTTCTTCCAGTTCGAAGAGACACAAGAAGATAAGAAACTGCCAGTAGGAATGGTAGTCGTATAAAGTTGCAGTGAGCAAGGGATGGCAGTGGGC
GGGAACTGGCAGCTGACGGTTGATCAAGAGCGGTTGAATGTCCTGTGCGTGACTCCGTTTCCGAAAGTGACTAAACTGCGGCCAAGGACGGAAGACGAGG
ACATGGCACTTCTGATGCTACTCAATCATGAGATCGAAGTGCCGCACGTTCCAAGCTTCTTAGGACAGTCAATGACGGCGCGTGAATTAGCGCTATTCTC
GAACATATTTTTAGCGATTGAATATCCTGTGTACGCGCACTTGGCACCGGGACAGAGATTTGGCGACAACCTGTCGAAACACGTGCTATTAGCGCAAATC
CACTCAGGAGCGGAGGCGGCGATGCCTCAGCGGCAGGAAATCATGGAGTTTAAGGCGACCATGTCGAGAATCTCTCTTGACATGAATTCGAGAGTGTTGA
AAGTTACTCTCAAAGGGAGACACACAGCAAGCAAATGGATTGGATGGAAGGTGCCATTTGCCAGGAAAATGCTGACACTGCTGGACTACGAAGCTCAGAG
AGAAGATGCGAAGTTGACGCATGAATTGATCAAACTTGATTATGACTCATTCTCAGTAGCGGTATGCAGAGGAGTAGTATCATCGAAGGAGCTATACTGG
ATCATCGCAAGCGGAGCTGGGTTGCAAGTGCAATCCATGAGGAATCTGGAGGTCGGTCAACAAGGGATGGATGATCAGCAATGGAATGTCAAGATACGAG
CAGTGGCGTGCCCAGAGAAACTAAAGGAGATTGCGTACTTGGCGGTTGATGGCGTTGAGATTGTTGTGCATCACCATGAGGTGCACGTCAACTGGCCTTG
CAGGGATTGCTATTCACCGGACCATCCGACCAAATTTCGCAGGACGAACCAAGGAGAGTTGAAGATCAGGAGGGCTCATCACACATACAGTATCGAAGGA
CGGCTACCATCGAAGAAGGTATCACTAAACAAAGGATACGATGTGGGGAGCCACCCGACTACTTTGGAACAGCTGAACGTGCTGTTAAGACCTGACATCA
CCAAGCAAAGCAAAAGGGCGGAGAAAGAAAAGAAGGCGGTGGAGCAGAATGCCAAGGACCCACCTTGTGATGTGGATGTGCCAAAAGAGGAGGGACCAGT
GCTACCTGCGGAGTGGCAGCAGCACAAACCATTGCATGGCGAAGACAATAGCAAATGAAGTGCCACAATAGGCGATGGAGGGAGCAGGGTCATAGCTGAC
AAGAAACTAAGCGAGGGGAGGGACACGGAGAGCCCATGGCGGCGCAGAAGGGGAGCATCGACGGTCTGGGCCGCATACTGTGAAGGCAAGACTGAGGACA
TGGCTCCGGATATGGAGATGGGTGAGGGGACGGCCGAAGATAATGACTTGGTTGAACCAGAGGAGGATTGCGTTGGGGAACATCTGAAAGAGGGCCCTAC
AGTGGACGAGCGGCCCAGAGAAAGGTCGCCAACGCGGAAATGGGTGATCTCATCGCGACAACTAAGGTACAGCAAAGATGCCAACTCGACTGGAGTAGGC
AGTTTAAGATGGAAAGCTAGCGACAAGATCAACCCACAATGAGGTCAAGAGCAAGGGTACAGAGAACTCACCCAAACGCCGGTGGTCAAGCGCCCAGCTT
CATTGTCGCCCAAGAGACGTGCGCCAGAGGAATGGGACAGTGAGCGACCGGGGAGAAGCAAGGAGCAGAGAGGCAAATAGCTACAAAATGCTCCAAGACG
ATGGAAGACCAGGTCGTTATCTCCACGTAGAACGACAATGGCAGACAAAGGGCTCAAAGGAGCCTGCGCCACCAGTTGTTTATGCACCAGTATCTGCATG
AGGTGAGCGAAAGGAAGAAGACGGGCGAGGAGTTTAGTGCGATGAAGCCACAGACACACGCGGAATTTCACGAGGTAGCGGAACAGCACACAGAAGTGGG
GAAGGTGGTGAAAGCGCGGTGCGGGGGCGACCTGAGCGAGGACGGCAGTGATGACGGAAACGATGACATCAAGGTCATCAAGGTGACACCAGTCACGGAT
GCAGAGGCACCACTGGAGGAGTGGTTGACGCTCATTGAAGGGCGGATAGTGGATGTGGCAGCCCAGACCAGTGTGGTTGGTTAGCATTCTATATGCAGCA
CTTACGAATTTCAGCGAAGGACTGTTGACACTCTGATGCAAAAATTGCGGGGAGGCCAACAATCTCAGGAAGCAAGTCATCAATGGCATGTTGCCAACCT
GGTGGATGAGAGTGGATTGCATCCAGTGGAATTGATGGTGGAATTGGACGTGATTGGAGTAAAGATCAAGGAGGTGGCCAACTGGGAAGAACAAATTTAC
GCGTTAGCCAACCACTATGCGAAGCAGCGACAAAAGTCGGTGAAGGTGCTGGTTCCTCTGCACTATTGGGTGCGACCTGCGCACATCAAGGCGATGACAA
TGCACGCCAGAGAGACGTTGTATGTGTTGCATGTGGAGGAGAACGGCATGGCAAGGACTCAAGTCTATGCTTACCACAACGTGCGTATCTCAACAGACGA
CTACATTGAATCGGGTACAGTGGAGACAATGGACACCAGAGACGCGATGCAGCTTTTCAGGGCTCTGACCCAGGGCGGAATACTGCCAACGGTGCTAATT
TTGCAATGGCTGAACACGGGTAATCATTTCCAAGCAGTAATTTATGACCAGGACAAGTACGCAGCTTACACAAAGCGGACGGACGGAATGGAGAAGACAA
GGAACAAGATCTTAGCGAATAGTGGACGCGTCGAGCTGGACGCAGAACCATACGATCACTTGAAGACTACCAAAGCGGCAGTGCGTAAGCTCAAGGGCAC
CCGCAAAGCCGCCAGAGTGCTGTACAGCAGGACGGCCAGCATGGACAGCAGAGTGGAAAGCAACTCGAGTAGCGAGGCGACGGAAGGCGACCGAGACAGT
GAATGGCCAGAGCTCAAGATCACGTCAGGGGAAGGGAGCGAGCGGCAGTTGAAGATGCGCCCGGAGAAGTGGATACTCAAGCGGACAATGAAAGGAGGAC
GACAGCTGCCAGACTGCTGCCACAAAACACGATGGCAGTGGAGAAGGGGCAAGGGCGGAATGAGCTACCCGGCCATGCTGCCCAAGAACATGATGTCGCA
AGTTATGGCGGGGGATCTCATCACAGAAGTTTCCTCACTGGGAGAGAAGGGGAGAGCTGAGGGGCCTACAGGAGATGGAGCACTGGAGGTATGCCAGCAC
GGTGACAGCAGAGTGTCCAATGACCAGTAACACAGAGATTCACACAAGGAGGAGGCTGTCATACTTTCACAGTCGACAATCTCTTCCTTCTATGGGAGAG
TAACGAAAGTGGAAACGAGCGAAAGGAGAAAAATGGAGTTCAGATGATGCAAAGCGAAGGCAAAGATCTGAAGTCAGCAGAAACAAGAAATCAAACCACT
GCTATCAACACAAATGACAGAACACTGGGCTTAACCACCATCAATGTTCGGGGTTTGGCCACACATATGGCACACCTAGGACGTAAACTGCATGGCACTA
AGGAAAAACATGAGCGAGGACAGAGAGACATTGTCTTTCTACAGGAGACGCACCTGCACGAGGAAGAGAATGGAGCAGCGCGGAATCAACACGCAGCCAT
GTGGGGCTTTAAACACAACAGAGCAAACAACTTCTCTTTCTGGTCGTCAGGGGAGAATAGAAGAGCAGGGGTAGCGATTCTTATCAATCCGTATGGAGAG
CTGCAGGAAGCGATGCCATGGGGAACGGAACACTGGACGGAGCATCTAATAATGATCTCAGGAGATTTAGCGGGGCAGAAGTGCATTTTTGTGAACATAT
ATACGCCATCAGCGGAGACGTGCGGTCCAATTCCTACAGCAACTACAAACGATCGAATTTCCGGCCACAACAATGATAGTATGTGGAGGATATTTCAACT
GTGTGGAGCAACGAAATATGGATAGGATAGAGGGAGACAGTAGAGACGATTTTGGGGCAGCACAGGTGGTGGCCAAATGGCGCCTAGTGGACGCCAGATT
CTACAATTTACCAGCGAAGAAAGGAGAGTAGGACATCAAACAATACGCAATTGAGCATCACACTCACACCCACAAAACGGTAAGTGAAGTTATAGGGTCC
TCACGACTGGACAAATGATATGTAAGGGCTGAGATCAAGAGACTGGTGAGGGGAGTGACAGCGGAAGAATTACCCTGCGGAGTAGACCACAGAGCCGTCT
TGATGGAGTTGCATCAACCACAAGGAGCCATCAGGCTGAAGAAACGGTCGAAGATTTACCCTCCGCCGGCCTATGTGCAGATGACGATGACCAGCATGAT
TAGGAGGAGGTTAGAAGAGCACAGGATGGAGCAGGATCAAGTTGCGGTGCTGGAGACAGGGGACAATTGGGACAATTTCAAGAGGGCGATCAAGACAGAT
ATGACAGAACTTAAGAAACAAGCGCGGAAGCGCATGAGTGACAGCTTTAGACAACACATCCGGAGGATCAAGAACAGGCTGGGGCGATGCGCCGGAGACG
GAAAGGAAGGAACTGCTGGGGCAACTGCAGAAGGAGCAGGATGGAAAGAGGACGCTGAGGCGAAGAGTTTTGATAGCCAGGAATGCCTGGACATCAAAAT
GTAACACGCGGCACTTCTTCCAGAGAATATGCACTAAATACGGAGACAACGTCATACCCACGCTGATCCCCAAGCAGGGTGTCACCCATCGCAAGCAACA
GGTCAAAGCGGACATTTTAGCAGATTACTGGGAGCCGATTCTAAGTGGGGCAGCAGTGGAACAGGTCTCTATCGAGGAATATGTGGACAACATTGTGAGC
AACTGGGAGACGGAGGATCTCACGGACATTGATGAAGACATTACCGAAGGAGAGGTCGAGCGAGCGATACACAAAAGCAAAAGAGGCAAGGCCTGTGGGC
CGGATGACCTGGGGACAAGGACAACAGTGAGTCGGTGGTGCCGATCTTAACGAGGATACTGAATGGCTGCATGGAAACCGGATTGACCCCGTCCACATCT
GTGGAAGCCTTCATTTCAGCATCAGCAAATGAGGAGACAAAAGCAACCCATTGAACTATCGGCCCATATCGCTACTGAACTCGGACTACAAAATATTTAC
TAGGATCCTTGCGTGGCGAGTACGGCGGCACATCACGAAATTGGTACACAGGACACAACGCGGGTTCATTCCAGGTAGAACAAATTCATGAAGCGATTGA
CATGCATGAAGCGGCCAATGCTGCATGTAGAGAGGGCGAGAGTTGACGGACGCGCAGGTGCTGTTGCTCGACTTCGTGAAAGCCTACGATTCGCTTGATA
GGGCGTTTTTGATGGAGGAAGGGGCTGCCACCTAGGTTTTGCGCAAGAGTGGCGGCAATTCACGCCAACACCACAGTCATGTTTATGGCGAATGGGGAGT
TTTCGAGGGCGGTCAAGGTGACAAAAGGCATACGGCAGGGTTGCCCACTTGCTCCGCTGCTATTTATTCTGGCGGTTGACCTGCTCTACGATGAAATAAA
AGAGTGACGGTAGACTCAGAGGTATTGCACTAGTCAGCGGTAGTGACGCGAGGCCTTTGAAAGTGGTTGGGTACGCCGATGATACGGCCATTTACATTGC
ACATCGAGCTATGCAAGAAGCAGAAATACAGACCATAGCACGTTTCTCGGCATGTTCGGTATTACAACTCAGTAGTGGTAGGAGACAGCACCTTAATTTT
AAGGCTGATGGAGACGCGGAAGGAGCCGACATCGAAGAACCTGATACACTGGTACAAGCGAACAAGGCGTCTCGCGGATGAGTAGCTGGCAGCACAACTA
TCGCGCACACAACAATATGGCGGATTGGTTGGCCAACCAGGCCATGGATCGAGGAGCCAGCACGATGAACCTCGAGAACCAAACGGTGAGATGTTGCCGC
TACTGACAGGGGTGACGGAGAGAGCAGACAACGATGCCAAACAATGGACAGACAGAAGGAGAAGAGGTCGGAAGGTGGAGAACGGAGAAACGGAGAAGCG
GAGATGCTAGAAGGAAGTCAGGAAGTGGGTGGTGGCGGAGGAAGAGAAGCGCGCAACCACCCAGTACTGGATCAGGCACCAAGTCGATCTGGAGTGGTGA
TTAGAGTTCAAGACCCAGGTCTTGTAACACAATACACATCACCCGTTGAAAATAAAAGTGTTACTCAAGGTCAGTGAGTTTCGCAAATGAACCGCGAAGT
GCACATTTGGGAAAGTGCTGTTGCCAAGTGATTTTATCACGGTAACATGATCACAGTGGAGAAACAGGGTATCGATCCCTGTATCCCGTATTGCGACTTG
GATCTTCAATTCGATGGTCCTTTATTCCTCTCGGCTCGATTTTGGGTAAAGAAGCACTCGTTCCAGTCCGCTCAGCTACTCTCGGGTCTCTGGTATTGCG
TACATAAAAGATGAGTACACCACCTACATATAAAGTTTAAGATACAACTTACCTTCGAGTCTCTTGAATTTCTTAGCAGCAC