Description :
From Genome Similarity Track
Location :
Scaffold_1004:875- 3863
Transcript NameFunction/comments
Phypl_g12021hypothetical protein

Sequence
2988 bases(100 bases per row)
GTCCTCATTCTCGAATTCACCCAGTCCACGCGAAGCAGCAATGAGTTGCGCAAAAAttggctgttgctgcgaaGACATAGAGGACACGTTGCCTTGCAGT
GTATGCCAGCGACCCGTCCACCACAtttgcagcaacgagcttTGCAGTCATGCAGAGCTTTCGAAGAGGTACGCATGTGTACCCTAGCAAAGGGTGCAAA
CAGCTTGCTAACGAAAACCTGAATATACAttttgcagcagcacgtgtgTCGACGTCGTTTTTAACACGGATAGCGACAGCCAACCATTGACTCCAACCAG
CACGTCCGACATCTCAGCGTCTAGCCAAGCTACGGTGATCAACCTGGCGCAGGACGAGCCTGAAGGGATACACAGATTCCCTCCACCATCACGCATCACG
CAAAATCCAACTCGACAGATGAAGTATGGAGTATTATCCACGTGTTGGACGAACCTGTGAAGCACCGGAAGAAGCTGTACACTCATATCTGCCTAATCTG
CGCGGAGACAAAAGCGTGGGAGAAGTCACTTTGCCGAACCGCCAACGCATCTAACGCTAAGTCTCACATCTACCTCAAAACCCAAGGAGCACGACATCGC
AAAAAAGGAGATCAATCGTCGTATGCAGCGGTCAGAACGCTTCACGGTAGGTGGGAGGAGCAAGCGCGACGTGTCGTCGGCTGTGGCAGAGGACGAGGTG
GTTGACCAGTCACAAAAGCGGCAAAAGGTGTGGTGGAAGCCTACGCCTACCCAAGACTTGATTACGGGGCATATCACACGATGGTTAATCCACGACGGTA
GGTTTGAGCGCTATCTTGACGTGAGATCATGATGATCATGCTAATTGTTTATTATTTCTACAGGGCTACCTCACAATATGGTGACAACACCGGCATTTCG
CGAGATGCTTGTTGCACTGACGGGGGATCCCAACGTTACCATTTTGAGTGCCAAGACATACAACGACATTGTCGACAATCACTATTACAAGTACCAGCGA
GGTACGAGAGAATTGGTGACCGACGAGCACAACCGCCTGCACGGCACCCCCTTCATGAATGTTTGCACGACCTCTGGACAAACAGCGCGAAAAACGACAT
TGTGGGGGCTTCTATTTCGTTCATCGATCACAATTGGCGATTTGTTCATTTGGCATTGCTTGCGGTCGCGAAGAACGACGGGCATGATTCGATAGGAGTT
GCAGACTTGATGAACGAGAAACTGCAGGAGTTGTTTGGTGTCGATATAGAGACGATGGTGCGTTTTACGATCTCTGATACAGCTAATGCGGCGCGAAAGA
TCTCACGACAGTTTGACACTACTCTTCAGACGGATTGTGCCATGCACGCTCTGAATCTATGTCTTGGGTACGGAATCGGCCTTAAGGAAAATGTGCGCAC
CGGGTATCAAACGGACCCAATGACCAATACTACTGCCAAGGCAAAGCAGATCGTGACAGAGGGTGGAGCCTTCCCAGAAGGAGGAGCGTTGATCCGGAAA
CTTCGCGCCCTAAATGTTCATTTTGCATCAAGCAAATCTCCCCAGCGAATTGCGCGATTTGCTGAAGTTCAGCGCTTCTACCATCTTCCGCAACTGAGTG
CCCTGCTTGACGTGGATGTTTGTGTTGCGTCCGCTATCAAGCTGCTGTAGCGCTCTATCGTAAACTTCACCGCTTTTCAAGCATATTTCCAGAATGCAGA
GTCAACGGAGAAGAGGCTGTTTGATTGCATTACCGCGGAAGATTGGCAAGTGGCAATTGAGTCGGAGGCCATCCTGCAACGGGTTGCCACACTGGCCCTT
GTGGAATCCCAAGCTGCCAACAGGATATCATCTACAATGTATGTATTGCTTCGGGTGGCCTCAGCGCGCATGAATACCTTCAAATTTGCAGCATACGAAC
TAAATGGGGCTCGAGATGAGGACACAAACGAAATTAATTTCGCTCGAGTCACGGTAAAGTTCGATGAGATTTCAGACTTGGGACATATATGCATCAAACG
CACCCTACATCAAATTGCTGCGCGGATGCCACAGCCGTCTATCCAGATGGGCATGGCTTTGTTGCTGGATCCGAGGACGAAAAAAGCAGCGAAAAACTAC
CTTCGTATCCCGGATACATCTGAAACGGTTACCGACCACATCATCGAACAAACCAAAGCGCTTCTTCGTAAAGAACACCGAGTCATTTACAAGGCCACGT
TTACGAGCGCAAGTCAGGACAATTTTGAGAatgcttcttcttgcagctcATCCGAACACGACGGTCAATTTTCGTCCGACTGCGAACTCGATTTATTATG
CGGAGAAGCAGTGACCCATCAATCCGAAGAAAGCCCGGTAGATGATGCTTTGAACGCAGTAGCAGATGGACTGGTGGAAAAGTGGCTTAGCCACCGTATC
GACTGGGCTGAAGTGGTTAGACACCAATACACCGACGAGCAAGAGCGCAGTTCCGTTCTGGACAAGCTCAGCATGCGTACAAGACAGGGCCACAGCGTCT
GGAACGTTGAGCAGCTCTGCATGCATACTGACGTGTGTCGATGGTTTGCAGAGTGTGGTGAGAATATGTTCCCTTCAATTGCGAAGTTGGCAAGAGTTTG
GCTCGGCAGGAGCTTGTCGACAGCGTTTCAGGAAAGGGTTTTCTCCACTGGATCATTCGTTATGAGTCCACTACGAACGCCTACTGATAACGAACGGGCG
CAGCGGCAACTAGTCCTGCGTCATAATCGGGCCGAGATCGTTCGGATAATCCCCGTTCAGCTCGGATTAGTAGTCttagtagtgctattagTAGTACTAC
TAATAATAGTTCCTGAAACTTTTCTCGATTTAGTAGAACTAATACTAAAATGGATTCAAAGTCCCGTTCATATTAGTAATATGACTAATTGATCAAAACC
CTTAGTACTATCAAACCCTGCTTCAGACGTCTAaactactatagtagttGTACTATAGTAGTGAGCTATTATTAGTCGACCACCTAAA