Description :
From Genome Similarity Track
Location :
Scaffold_174:875- 2982
Sequence
2107 bases(100 bases per row)
GCAAAATATGCGATGGGGTCTTATAATGAGGTTTTTACACCAGTGGTGCCTCATCCTTCTCCCCGGGGTCAACCTGAGAGTCGACCTGGTAGGTGGTGGA
TTCATACGCCAGAATCATACACTTAGCGTAACTTTGAGATCCCACCGAGACGAAACTTGTGCTATTGGTACTTAATCGTTCATCAGCCACATAACTGTCT
TGGTACTGTTATGTAGTATTAACGTGTATGAACTGACGTTGGTACCTTCAGCAGTTGTCGGCGTCCTATCCCCCGGGTCATACTTGTAACCCATCAATCT
CCTCTTGTTACCCATATCTTCCATTGCTCTGTGGTCGAGTTTTTTAAGGTATCTACACACACACCAGCAAGTATAAGCGCATATTGTCCCAACCTGAATT
CTGAAACTCGGTTATCGTAGACGGGCCTCCATCCGGAGAGTTTAACTTGAACTTCGTTAGGAGACAAAGTGTTCCGTCCGCCAGGTCTAGCCGGATACCA
TCCGGAATCATGAAGTCCATTCCTAAGATCTCATCGTGACCCACCATGGAACATACTTACGGATTAAATACTTACACTAAATTTCCATTCAGGGTGACTT
TGATGCGAGTGCGCTCTTCCGTAGAGTATACTTATTCCCCAATGCCAATGCACTCTTGTCGTTCAGTTTCGTCGATTTGGCAGCCTACCTTACGAGCAAA
GGCGATATTTAAAACAACAAATTTGCACGATCGTTGTTAATCTTCCCTTTGGCTTGTTTAAACCACTTAGTGGATGCACGGTATGTCCAGTAACCTCTGC
ATTCGCCGGGAGGTAGGTCTAACTCCATCACTGCATTATCTCGGGCAAATCTTTAGGTTCATTGAGAGAGACAACATGGACCACAGAGTATTTTTTATCT
TCGATGTATTATCGATCTTCTCAGTGAAGAAATTCCTCTTGGGATGCTTTTCCACATATGCAAAATCTAGAGCGCTCGGATCGTACCAGATTCAAACCTG
GCGAGCGTTCTAACTTATCATCTTCTCAGCCTTCTCCGTCAACATTCCGGCGTGCTTGATGGGGTTGTACCATTGGCATATCAAGTTATAAAAGTCCTCA
AACTGGTACTTTCACGCTTCATGGGTCTCTCCGCGTCCTCGGCACACAAATAAGTAGCGATATGATGGTTAAACCTTCTTCTTGCAGCGGCCACAGGTCA
TTTCCTTCATGCATATCAAGTCTACATGTTTTCTGGATCCGCAATTGTCACAGCCCACGTTTGACTCGGCCGACCTATTGCGGGGTCCCGGGTACATCGC
TTGTTTCCGATGCTGGTCGACCTTTCCGGTGGTTCATTACCTCATGGTTCTTGAACTTGGGTCCCTTTCCGCTTCAGTTAAGTAGAACAGTCTTAGGTAT
TCGTCTTTATCCAAGTTATCCAGGCTGGATACCTCAGAGCTCGACTCTTCCAGAGCCGCTCGGACCGCATGTACGGAGCGGCATTTAACTCTCTAACTCA
TTCAGGAGGGGCGCGCACCTTTTGACATAACTTGATCAAACCAAAAAAGCGTCTTGCCATGTCGTGCCTTCGTTCTCTGATGCGCCCTCAACATTTTTTA
AGTCATTTACATTTTGCGCCCTCAATATATCTTCCAAGTATTCCACAACTAGCATCGTCAATTGGTCCGAAAATGCTGGGTCATCTAAGGTCTAGATATA
ATGCTCCACATGTTCTTTCTGAATCTTGGGCAATCCATTTTATATCATTAACTTCTTCTCGAGTGTAATCACATTTAACAATACATATAGTCAAAGGTGG
ATTCATCTGAACTCTTCTTCGCGTGGTAGTACGGGCGAGCAACTGGTACCCCAAGACCACAGAACCGCATCTGATATTTTTGCAGCAGTCTTTCCAAGTT
ACTCGAACTGAGCGACTTAGTTGGAGGTATGAGTTCTGTGGCGGAGCGTTCAATATCCTCCAAAAAAGATACACTTTTTTCCGTCTGTTGCTTGGTCCCT
CGTGAAGACGGTCTTCGAAGTGGCCATCGAACTGCGTACTCGGTCCCCGTCCAGGCATTGTTCATTGAATTTTTTGAGATCCAAACTCGCTGGGTCCTTG
ATTCGGG