Description :
From Genome Similarity Track
Location :
Scaffold_2784:875- 2565
Sequence
1690 bases(100 bases per row)
GAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACCCGCGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAA
GCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATACCTGTGTTTCCCGCCTTAT
CCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGTTCGGCGCGGACTT
TGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCTGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCC
CGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAG
CGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTC
GCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGACATGAGCT
AATTCGTAGTCCGGCCTGCGCGGGAGCGCATCGGCCACTACATAAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCC
ATCTTGCCATTCTCTGAGAGAGATGAGGCGGCTGTGTCGCAGTGCGTAGCGATGCATGATCAGTAAATATCACAAAAGACTTAGAGCCTAGCAGGTGTAC
CTTAAATTTGACTAGAACATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAATTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCAATC
ACGCGTTCACGCCCTACGGCGTCTGCTTGTAGATCGCGAGTCTCTTTGGAAACGTGTTCGTCTTGACCAGGGATTGATAGTAATGGCATTTTTGTCAAAC
TGATTAGTAATATTTGGAAGACAAATTTTAACCTCATAACTATCAATAGAGATCTGGATCGGCATCGAACCTACAGTGGTTATTAATATTAATATTTCAG
CTATTAATAAGGGCCATTCTTTGTCTAATCAGGGACTTGAAGAGCGAAGCTCACGCGATTCTCTGAGATCAAGATACGGCTTGGACGTACGTCAGGCCGC
TGGTAAGTGGAAAGTTACAGTATTTACTCGAGGATGTAGCACTTGGTCGCGTTCCTGAGGCAAGGAAACGAGATATTTTGGCGGCTTTATTGCTCATTCG
TTGTGGCTTTACTTTTTCTTGGCTGTTGATTACATGTAGTTACACCGAAGCATCGAAATCAGTACAAGGATCGCATCATCATTAATCATATCGATCATAA
AGCTAATCCAGCTTGTAGCACCAGTTACTGCGAGCTGATTGTACATCACTAAGGTGAGTTGATTGGAATTATTTGCTAGACATGAGTGATTCTAGCGACT
AAGTGACTTGAGTACTTATTGTCGTAGAGCAACGAGTATAATCGCGGCGATGGGGCGAACAGTGAAGATCGAAATGTCTACAAAGACGCA