Description :
From Genome Similarity Track
Location :
Scaffold_4369:875- 2112
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4369-snap-gene-0.1Pumilio-like mating protein M90

Sequence
1237 bases(100 bases per row)
CCACGACGCGGCCTCGATGCACTTTTGCAGTACATGGTTGCCATTCTGATCGGTCACACACTTCAAGACGTGGCCCCGCATCTCCCGAATCAACAGAAGC
TGCTCGTCCACCTGGCTCACCTCCAGCGCCTTCTGGATGACGCGGCAGCCATACACCTGGAGCGCAAGGTTGACCATGTTGCTCTTCATCAAGCTGACGA
GGAGAGATTGCTGCTCGACACTTCCGTGGTCGAAGAACTTCTGGATCACGTAGTTTCCGAAGACGTCTGTCATCAGAAGCAGTGCTTCAGGAAACACTTC
GTTGAATGCCTCGTTGCGGACACGATCATCGGCCTTCTCGAGCTTCAGTTGGATGAATCGGCTGCCAGCTTGATCGCGTGCAAACTCGAGGAGATGACCC
TGAATAGTACGGAGATCCCACTTGTCGGACTTGGCAGCGCCTTTGAACTCCTCGAGCAAACTTGTAGACGAATACGAGTGCGCTGGGTGGATTGGGTACT
CGGTGCGTCGAACAGGACCGGATTTGGAGCGGTACACGGGAGCCTGGTGGGGGATGCCGTAAACCTGGTGGTCCTGGTTGCCATAGCCTGATGCCATCGG
AAAGATAGGGTGGGGATGACCTTGAAATGCTCGCACCGGGACGTTGTGTGGATTGTAGGGACCACCTCCGAGCCCGCTTCCGAAACGATTCGGATAGAAA
TCGCCTTTGTGAGACACACGGCTCGGTGGAGGCATCATCCCGTAGTCCATCGGTGCCACTGAGAAACGAGCACTCGGGAAGCCAGCCAGATCGTCACTGC
GTGCCCAAGGAGAACGCGGATCGTTGGCCATCGCAGCGCCATAGATCCCCCTTGCCGTTGAAGCATGAAAGCCTGGTGGCGTGACGACCGGATACGGGGA
TGTGTAGGCTGGGTGGCTTTGGACACGCTGTGGTTGACGAAGGTCGTGAGCACGTGGCTGGTAGGCTGCAGGAGCAAACGTGCGCTGATTGCGATAATCT
TGCTGGTGGACATTTAAGCGAGCAGCGTTCTCGAAGTTGAGCTGCTTCATCGCAGCTGCCATCGATTGGTCAAGCGACCGAACAGGCAGTGCGCCAGACG
ATCCTGATGGGCAGCCGAAGACGGGTGATGGCGTTCGCGGGAAGTCATCCTGAACACGATCGACCAACGTCATCAGCGGGGCGCCACGCTTCTCTGGGTG
AAAGAGCCCACTTTGAGCGTGCGGTCCATTGCGTCGA