Description :
From Genome Similarity Track
Location :
Scaffold_271:8749- 10500
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.14Inositol-3,4-bisphosphate 4-phosphatase

Sequence
1751 bases(100 bases per row)
GTGAACATGACTGCGTGGATGTTGACTGCCTCGCCCTGTTTCAGGATGACAGGCAAGCCAGCAAAGATCTCCGACGGCAACGAGAACGTGACGACAACTT
CCGATCCCTTGGTAGCCAACACCTCTATACACTTTGCATACTTCAACGGAGACGCGTACTGTTCGCGCAACGACTTGGACGCGACTTCAGCTTCCACGAC
GCGCAGGCTCACCGAGCTGTTCAGCCATTTCACGCCCTCGACCATGTCTTCCAGCATGCCCTTTTCATTACCCATCGTACTCAGTAGCGACTCAATGTTG
AGCAAAAAACCCGTTGAGCAGATCAGCTTCAGCCGATCCATATGGACAGGCGACTTGTTGTTCACCGCGAGGCCCAAGACAGTGAGGAACGCTGCCGACG
CGACCGAGAGAATCTGGCAGCGCACCACATCCTGACGCTGCTCAATCTTTTCCAGGAGCTCGTCTTTCGGTGATTGGGACGCAGCGGCCAACAACCTTCG
CAGTCCGCCTTCTTTAAAACCCAAAACATGCGCTGCTGTGCACCCATGGGTAACCACAGTGTGCACGTGCTCGTCAACGATCGGTGAAGATGCACTGCTG
CTGCTGCTATTACCACTGCTGGAGTCCATACCAGGAGTGATTGCACCTGACGGATGACCGCTGGAGAGAATCACCCGCTTGGCCCGCGTGAGGTGGCAAT
TGAGATTCGTTGGCATGAACTCCGTAAGCAAATCTTTCTTCTGCGTACTGCGTTTGAGACACCCCGTCAAACCAGGCTCCTTGCCTTCTTCAAGCATCAC
CTGCAGGTGCCAGCAGTAGTCTTCGCATGTTCGGTACAGGTCACGAAGTCGTGTGTAGCGATCGAGTTGCGATGTCATGTCTTGGAACTTGTCATATTCA
CTGGCATAACTCTGTTGGGACTTGTGATGACTCGGCGACGACGGTACAGGTCCATACTTTTGCTCAAAAGCAGCCTTCACCAGTCGTGCTTCGTCGATAC
GCGATCGATTGCGAGCTTGAACATACCGCATGAACGCGAGAGCCACGGAAATGGAGCAGTATGATGCCGACAACTCTTCGGTGATAAACACGTGGTTGGC
ATCCTTTGAATCAAATTTACCGCGGACCATCTCGCCGTAACTCATACCAAGACTGCTTGGGACACCACCCGTCAAAGGCATTTTGTCGGCTGCCGTTGGT
TTTGTCTTTTCAAGCGGGACGATGTCGGCAACAAAGTGGCGCCTGGCGTATGTGTACGTGTGTCCTAAGTTGATGTTTTCGCTTGGAACAATACGCTCCA
GCAGCAAGAACAATAACTGCTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCGATCGACGGCACTCCAACACGATCGTCGAATCTCTCGATA
GCATCAAGTCAACCGGTGAAATGCGCACAAACGCCAGTGAGACTTGATCCGCAAGAGACTCAGTGCCTGGGTTCTTGAACGAGAAAACCTCAAAATGAAG
CATCTCCTTGGTGCTCAAAGGCACCGACAGCGACGCGCTGAAGTCTCGCGCGTAAAAATCACCTCCACAAGCACGCAGCGAGCCCAGCGTACCTTGCATC
TCTGTGCGTGAGATCTCCTGCGGTTCCTTTCCAGGAAAGACAGACGACAGCACTACCACCATATGCGCAGCCTCTTGTGTGCCTTTGCTCCCAACCGAGA
CGGCCAGTTCAAGAGTCGGTCCACGCTTGAACGAGGGCAGGCTCAGGCAGG