Description :
From Genome Similarity Track
Location :
Scaffold_34:87484- 92473
Transcript NameFunction/comments
Phyta_totarag1706hypothetical protein
Phyta_totarag1707hypothetical protein PHYSODRAFT_321807

Sequence
4989 bases(100 bases per row)
CCACAACCCAGTTGGCTCGTGTGGCCGACCGCTCGCCACTACTATTGCCTCTACGAGCTGACAATGATGCAACAGATAAAGCGTTTTCACGGTCGTTCAT
CGTCGCGAAAATCCGCCCAACGCTCGTGCATGTCCTGGCTGATGGCCGCGTGTGGGTGAGTGGAGTTTAGAGCACTGCAAACGACCAAGTCTAACCAAGT
CTACCATCACTCTCCATTCGTTTAGTGCGTGATCAGGTTCAAGATGCCAATCACAGACGTCGCAGAGTATTGCAGCAATCATTCTGAAGCTCGTCGCAAG
ATCCTGGTCTCAGTGGCAGATGGGAACGTGTGGTTGGTGACGTTGCCAGATCATTTGCAGTCTGGAGCGGGTGCGGTGCTGAATGAATTGGTGCTGGAAC
GCCTGTCTAGTGAGAGTGATGGTGGAATGGTGCAGTGGTTCTGCCAGTTGCCTGGAGTGCAGTCGGTTCAACATATTGCAGCAGAATTGACGTCACTTAC
TCTGATGAGGAGCTTAGTGACGCCTTCGACGTTGATTGTGAGCACTCGTGGGAGCTCTGAATCCAAGTTGCAACGTTACCAGTCGctggaactggacgag
aTTGAAGGCGAGCAATCTACGTGCTTCCTTTGCTTGAATAGTCAAGAGTCGAGTCATCGTGGGTTGTTGAAAAGCTTATTTCCAGACGTGGTGAATTATG
CTGGCGTGGCGGCTATCCTACAGGGGGATCTGGATGGAAGCGTGCGGTTTTCCTTGGTTCAGTATCCTTGCGTGAAAGGAGAAGTCACGAAGGCGTCCGT
AATTCGCAGCGGGACGCTTCTTCGGCTGGATCAACCTGTTCAGAGGGTCGTTCCGATCACGTCTTCCGTGCCACTAACACCACCCTCGGGAGGGAATGTa
acagcagcgtcctcaGTATTTGATGCGCTGTTAGTTCTGGGTGCTCGAGGGCGCATTCGGGTTGTTGATGTAGCGACTGGTTGTTCGATAGAGACCCTTC
CTGTTTCATTGACGAAACTGGAGCTCGGGCACGCTGTGCAGTCGTTGACATTTGTGAGCAGTTTGGCAGTGTTCATCTTTTGCTCAAGAGGTTCGGCTTT
CGTGTTTCGAAGTACTGATATACTAGCGAAAGCGCAGTCTGCAAATTCAGAAGCAAATGTTGCCCTGAGCGATAGCCCCAGTACCTACGCCGAGAAATTA
CCCCTTCAACCGGTACGCGTGTCATCAAGTTTGCTGAATAGATCTATGTCGCTGACGAGTagtgtgtgcgtgtgtgAAATTCCAGGGCATCGTACGCTTG
GCAATTCATGACAACGCACGGGGTATGTCAATTCTCTTCGCATCAGGGCGGATCACAACAATTGATGAGGCTGCTCTTCGCACGATGGTGGCCAGTGTGC
TAGCATTGCCTGAGCAACAAAGAAACCAAAGGGCACTATCGTCTGCAAGAGAATCAAAGAGTGACGCTCGAGTTCGTAATCTGTTGCATCGCATCGCACA
AATTTCCACCGAATCAACTGTCTTGCGCACCGAATCGAAGCAAATGGACCACCAGCTCAAAACGCTACACTCGGCTTTGGAAATGCTGCGAGTTGTGAAA
GCACAAGGTTTGTCTGACTGATGTCGTATTATCGTTAATGTGATCGTTTCCTCATttcttcgttgctgctttTTGCAGGCGTGGAGTCGATGATCAAGTG
TGAATTGAGGGCATCAATGGTAATAACAGGCACCTTCTCGGACCGACAGACAATCAAACTGGTGTGCTCCTTACGTTTCGTGAAACCCGAAGTTATCGTC
TCACTCGATGAATGGTAAGTGGTGTATTGGGGCATCGTTCATTTGTTGCGTGTAGGAACGTCCACTACGTATCCTAACGGTACTCTATATCGTTTGTCGT
GGAAATAGGTGGTTGTGTATGTATGTGCGTACACGCCAGTGTGCGGTAACGACGTACTCGTTTCCACTGAAAGATGCATCCTTGCGTGGAGAACAAAGTA
TCATCCTTGATCCAGACACACTCGCTCTACAAGATCAGGGAGCGTTGTGGGTGTCGTGCTCGATTGTATTTTGTCCCTCAGGGAGTGGACACCCAGAAAA
CAAGCATAGCGAAGTGAACGGTGTTGAGTTCAAGACAATTGATCAGGAGGACCTGTTGTCTTTTGCGATCCCGCTTCTGCAAGACCGAAGGTTCCTGTTC
GCACAGCTGAGTCAGcccgtcgaagaagaaactccAGTCAGTCAAGTTGCCATCCACGCTGCTTTCCGTCAAAATCATGAGCCGTTCATGCAAGTTGGAA
GAGCGAACAAAGGAGGAAAAGCCTCATCGTCTGCACTCTGGGGTGGTGTGCAATGGTGGTCTGCACTGGCTGATCACGCCCATAAGAACCCATCATTTGC
AACTTTGTGGTCGAAAATTGCCCCTCCAGATGCGTTATCTCCACCTTCGCGATTTGTGATCTCCATCCCTTCATTCTTCgtcgcagaagacgaagacgag
gatgacgaagacgaggatgaagattTTGAGAAGGTTCGCGTCGAAAGGATGGTGTCATTCCTGCGTCAGCTCTTGGAGATACCCAATGATGAAGTTCCAC
GTTTGCGTCGTAGCTGTCGAACACAACATGGAAAGTTATGGACGGTGTTGCGATCCTTCTCAGGGAGTCTTATACTCCTACGTTTCACGCCGTCAGAAGA
CCATCAACGATCAGTTGATCTCACCATCCAATGCTCCGACGTGGCGGATCTCTCAGCAGTACGTATGCGTTATCGGCGTAGCTCTAATCACTCTTAGACT
AACAAGCATTGCGCCTATGATACTGTGTAGATACGAGCTCTTGTCCTGGAGGCGATCAACAACTGGAGTGATGGGGCCTCTCGAGGAATCAGCGAAGGCG
ACCGGTCTGAAGAGCTAGTATTGGACATGAACGAAATGTTGGAGCCCATAGCAGCTCTTGAAAGTCTCCTGGAGGTGTGTAGTTGGATTTTGACTCATGA
TACCCTGGCATTGCAGTTTTACTAATCTGGTTGAACTCATTTGGCAGGATCTGACGCTGAAGACCACTAACAGTATTGACGACCCCCAATCGGCTATTTG
CACTGATGAAGTGCTTCATGCGCTCTCGCAGCTAACGCATTTGGAGACTCAAACGCTCGCACTTTACTGGAAGACAAGGTTGCAGCTTAACAGAACCATC
ATGTAAAGAGCGCTGTCCATGACGGTTGCCGCACTAATTGGACTAGAACCATAAATGTATTGCAGGTGCAACATCGAGGGCTATCGTTAGCAAACCACCA
GCGAGGCACTATTGGCGTCAATCTTGTTGGCTGGCTAAAGTTCCTCAGTGGGGAGATGTTGGTCACGCAAGGAAACTTTCTCAGAGGGCGAAGAAACGGA
GTAGAGGCGCTACACGTTGAGCACAACCCCAATTCAACAGAGAACTGTTAGTTCGTTCGAACAAGTAGCAGCGATCCTGTAATTGCAACCAACGCTGTCA
CTGCATTCGTACCTCAAAGTAGCGGGGTGCTCGAGTCGGCCACAGCGTGTAGATAAGGGTCAAATAGATAAAACAATGCACCGAGGTCGTCATGGCTGCC
ACTGTCTTCTCGCGCACCCACGTCGACAAGAACGATGCGATGAGCACGATGATAGGTAAGGCTACGAAAAACACCGAGAACAGGCAGCACATCTGAAACT
GGGGTAAGCGCATCATTTGGTCAGTCAACCAGCAACAATTCCAGCACTTACTCGGAGGAAGAAGTGCCGCTTTGTCGAGGCTTTCTCGTAGGAGCGCGTC
TCCAGGATGGTGTTGATAAACCACCCTAGCACGCACGTCTGTAGCACGCAGATGCCAAGGCCTGGCCATGAGTCGTAAATGTACAGCGTCGATGCTGGAT
CAAGCCATACAAGATACCACATCGCCATGGAAAGGTAAAGCACGAGAATAGCCAGCATGACGCACGAGAGCTTGATCTGGCCGTCCAATTCAACGCTGTT
GATAGTCCATCCTTTCGCGATCAGCATTGCCAATAGCAGTGTGCCCACTCGAACAAACACCTCCGTGATCTTGGCCGCATACTTGAAAAATGGCACGCCC
ACACCATTAAATTGGTACATGGTGAAGTGGGCGCAGAGCAGCGCGTTGCAAAGGAAGAaaaacagcaccaccagcgtaAGAATCCTCATGATCGGGTGGA
AAGACTCGCTCCGCGTCATGCCCCTCACTGCCACAATTTGCGCCGCCACTGCAGCCCCCGCAACCGTCGTCATGACTGCGTAGATCGTCGGCATCCCTTG
CTCTTGCACTGGAAGTTCAGTGCCATCTCCCTGCGTCATGTGGATCTTAAACCAGGACGAGAAGTAGTATTTACGGAAGTTGGTCTCTGTGATCTCCGTG
AAGGAAGGTTTGTACTTGTCCCCACCGGGTACACAGCGTGCCAGTGCCACATACCAAAACCTTGGCCGTAGATGTTCATGAATGTCCACGTTGAAGGAGA
AGGGGGTCACGTGGTGGTTATTGGTGGCTGTCACGTTGAAGACGCCTTTGGTGTGTTTAGCGGAGACTTTGCAGTAGCAGTCGCAGGAGCTGTCGGTCAT
AACGTAGTTCCAGAAGagcgcctcgtcgtcgtagatGGCGACTTGGAGCCCGTTCACGTCCGTCTCGACCTCACCCGCGAtgtgctggcagcaacaatcA
CCGTTAGTTTCGTACACGTATTGGCATTTGTGTATATTTCGTTTAGGTGTTGTAGTTTCGTACCCccgcgacgtcgtcgagtgtGGGCGtccaggagaag
cagaacttGCCGATGTATTGGAATTGCCGCCCCACAGTGTAACCAGTGAAGATGCTGCCATGAGCCTCGGACAGGAGCGACGAAAGGCTGagtaacagca
gcaggaaaagCGGGCCCATTGTTCTCCCGACGACTTGGAATCAATCGAGCGATCTTcgattgcagcaacttcaacgaggCTTTTGATTG