Description :
From Genome Similarity Track
Location :
Scaffold_23:874806- 878293
Sequence
3487 bases(100 bases per row)
GTTCCTTCACGTTGAACAGCATTGGCCATTTTTTATCACTCTGACCTTTTCTGGGTCAGGGCGTACTCCGTTCTTCCCGACGAGACACCCAAGCATTTCT
TCATGTTCGTGTAGAGCTTGTGTTTATACGTATTCCCTAGCCGCTGACGGAGGTGCTCTTTGTGGGCCTCAACGTCGGTCTTCCCGTCCACATCCCGGCT
GTGAATGAACACGTCGTCGGATGCGAAGTCACTCATTGAACGCTATAGATGTGTCACACCTTGAAGGTTGCAGGGGAAATTTTCAGTCCCTGCGGCATTA
CGAGCCACTCCCAAAGCATACCGCTTGGAGTGCTCACCGCCGTGAGAGGGATGTATCTCTCACGCATCAGGATCTGATGGAACCCGTCGCGCAGATGAAG
TGCACTATAGATGACGCACCTGGACATCGAATCGATGATAACATATTTTGTGGCATCAGCGTCTGCGCCAGTATCGTCGCATCGCTTAGCTCGTTGTATG
CATAAACGATGCACCACCAGCCCTGGGGCTTTTTGACACAGAACGGTGGTGCGATGTGCGCGAACTTTGATTCCCGCACTTGACCCGATTTACAACGACT
TTCAAAGCAGTCGTCGATTGCCTTTATATGATCCCGCGGTAGTGGTCACTGCTGCGTCAAACGGTAGTTCATACGCTGCACGAGATCGATCTCGTGCTGT
TTGCTCTTGTTCTGCGGAAGCTCAGTTGGTAACTCGTGCAGTAGAAAATCCTTGTGCTCCTGCAGAACAGTGTAAATAGAGTCGACTCCAGCGAGTCCCG
GCGGGGCTCCTCAAAGCGCTGGTTGCTCGTCTTCGCACTGAGGGTATCCTTACTCGCAGCGGTATTCGCAACGTCGAGTCGTCTCAACTCTTTCGCATGG
CTTTTTTGTTCTTTCGGTATCCGAAAGGATGCATATCTGTTCGATGCGTTCATCGTTCAGATCCTTCGCGAAGCGCATCCGGCTCATGACGGGAAGGGAC
GTCAATTCCGACGCACGCGTCGGAGGATTCTTCAGTTGCTCGACCTAAACTGGGGACCAGTACGGGTCCGCGTCAAGCCTTCAACGTCTCGACACACGAC
GTTTGCTTCGTGTCAGCTGGGCGGGGCATGGCTTGTATCGCTTCGGCCCCGGACCGAGCCGTGTGCAGCTTTCGTCCCTTGGACTGTCTTTTGTTCTTGT
GAAACGTGGCTTCTCATATTTCCTGTTCAGGCAGGGTCTTAGACGGATTTCCGCTGTAATCGTCGGCGGACTGGTTTCGCGGACGTGAACGCTCAAGCCC
GAAATGATTACATTGCGCTTCGTCATGTAGCCCGACTGCACGCGAAGACTCACGCGCTATCAGTGCTAGACGTTTACAACCGCCAGACCGGCTTGCCGCG
TCGTCAGCTCCCGGAGCTGAAGCGCTGATATCGTCTTGACGCCTTTCGGCAGAATCCCCTCTCTATGTTAATATCGAGCTTGTATCGATTTCCGGAGTCG
GCACGTCATGTCACATCGACGCCTTCGTGGTTTTTGAACCAATCACAACCGTGTCGGCTCCGGGAGCGGACAGGTCGATTTAACAGCTACTGGTTGTAGC
TGAATCTCTTGCATATATGAAGCGTCAGATTCCGGGATCGACGCACCACCGTCACAGCTCATATCTGTGACCGAAAGCTCTTCCATACATGATCGATCAA
CTCTTAGAGTTGATACGGTAGGAAAGTGTCTCAAATCTGATTTCAGGTTTGAGACAGACTCAGCGACTGCCTCAGTCGTTGCGACTTGTGCCTGGGCACC
GGATGCTGCAGCGTCTAATGTTTCCTCAACAGTGAGATCGCATCCACCTTACGGTGCATGCGCGACCCTGACAGGGCCATCGCTCTCTGTCGCGTTGCGT
CCGAAGTGCACAAGTGTACGCTTCTCCTAGTTGACCACTGCATCATGTTGTGCAAGCCACAGCATCCACGATACCAAGTCAAGCTTATCGTCCAGGTTGA
GGACGATATGATCCTCCACAAATACCCGGTGTTTGTACGAGATGCGCACGCGTACGACGCGCTTCTCCCGTGGCACCTGTTGACAACCGCACCTCCAATA
CACTTCGAGGTGTTTTAACCTCCTCGATGTTTAGCTTCGAGAGACTTTCCTGTCGAACAAAGTTGTTCAACGCACTTGAGTCAACCAAAGCACGAAGAGA
GCCTGCTCGCTTCGACGTCACCTTCAGGATTACTAGATTTGACTGCTCTCGCTGGGGGCTGCGGTACTCAATGTTGCTTGGCCTTTGAAGACAGCAATAA
CAGTAAGGCGCCCCGCATCTACTGCTTCCGCGCGTTTTTTAATGCTCGCGTCGGCCCATGACCGAGTGCACAGGCGCTGTGCACTCACGCGCAAAGTGTA
CACACATCGGACACACCGCACAGCGCCTTCGTAGCGTTGTAGGCGTCCAACTGCGTAACCGTCCTAAGGCTCACTGGCTTCGGACCTTCCGTTCTCGTCA
CCGGACGTGCCATTCTCGGCACGTTCATATGCAGCTTAGCCTGCTTTAGGCTAAGCTCCGCTTGTATCGCAGGTGGCAAACGCAGCTTCGAGTGTACCTG
GATACGCTCGGAAGAGATAGATATTGACAGGTCCAATTATTAATCTTTTCATGAACGTGACGACCTTTGTCGCCTCATCGATCGGATTGGTCACGATGTT
CGAGACGAAGTACTGCGTACGTTGGGCGTAAGCATGAACGTCATGCGTACCTTGCTGCAGGTCGAGAAAATCCGCTCTCGGAGCTCCTTCTTGAATACCA
CATACATATTAGAGCACGCATGGTCTGTGAGGCGGCATCCATACGCCCAGGTTCTCAATGGTTCGCCAAGACATAGTGAATTTAACCTTCGACGGTTCGT
CGGTAAAATGTCGAGCCGTAATGGCAGTGTCGACTTCGACAAGCCATCGGAGGAGAGGCTCGCCTAGTTTTCCCACATAACTGCCCATGTACAGTTTCAA
CGAGTACACGTGCGATGTTGTCTCGGACGACACCGTTGTAGCAGCAGCAGCATCGCGCTGCTCCATCACGATGAATCCCAGAGCAACACCGTGTTGATCT
GTCTGCGTACGTAGCATTGTTGCTACGGTGGCCTCTCCAATGACTGTTGACAGTTTTAGGAGAGCTTTTTCGCTCTGGATCTGACAGATGGGGGCCGTCT
TCACGCATAAGGTGTGTGGCAGAGGCACTTGGGCTACGCATGGATGGATTACCGTCCATGGGCTGGTTCTCCGCCCGTGTTCGTATTCCAAACGAACTCG
TCAGGTAGTCGGTCATTGGATGGACTACGAAGTGCTACCAGATGTAATGGGACTACGAAGTGCTACCAGATGTAATGGGTATAACTCTGTGCCCACTACT
ACGGCTTACACGTTAGCGCGCGTGTATGAGATGCGTTACACCTAGATTAAGTATACTTTTGTCCAAAAGTATAGCTATACTTATATA