Description :
From Genome Similarity Track
Location :
Scaffold_2:8745- 12103
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-fgenesh-gene-0.5DEAD/DEAH box RNA helicase

Sequence
3358 bases(100 bases per row)
AGACAGTATCTGATTGTGTCTGTCTCTGTTTTGCAGCTGGTGCCGTACGACGTGCTGATGGAAGGGCTGGATGTACCCACTGTGCGAGAGCTCGAGGACA
TTCTGATCGAAACTATTTACTCTGTGAGTGATCTATTTGCTGAAGCCAATTACTCAGTAGATTACGGTCTCTAACATATTGTGGTTGTCTCATTCGCTCT
CTCTCTCACACACACAGGGTCTTGTCCAAGGCAAGTTGGACCAGAAATCCCGCTCGTTCGTTGTCAAGTACGCAGTCGGACGAGACACTCAGAACGAAGA
CATCGACAGCATGATCGCGAAGCTCACCAGCTGGTATGATTGGTCACGTGGATCTCTTGTTGCGTCCATCTTTGGGCTGGAGGTGCTTAACATCGTGTGT
TGCGGTATTGTTCATTACGTGAACAGGAAAACTGAGTCGGCGAATATTCGCACCAAAATCAACGACATCCTGATGTACGAGTTCCCCTCATCTCTTATTG
TATGATGTAGCTTGCTGACCAGTCACTCAACCCTTATTCGCCTGTCTACTTGCTGTTTGTTGTTACAGTCATGCTGAGAATCTGGCCGAGACTGAGAAGG
ATCGCGAGGAATCGATCCGCAACAAGATCGCGTCTCGAGCAAACAGTGACCGCGCGAAGTATCCAGGCGGAGCTCCTGGCTACCGTCCGAATGACGACTT
TGGCATGTTCCCTGAGAGCGGCGGCTACGGCGGTGCTCGTCGTGGGTAAGTTGTTATGTTCGATGGAATACTTGAAAAGTGTGTCGGTCAGCTGACGTTT
GATGAACTGTGATGGGTTGCTGTATGTATGTAGCCCTCCTGGCTCCAAGCAGCGCATGCACAGCATGGGTCGCAAAGGCCGCAACTAAAGCCGCGGCTGC
CAGTTCTATTGCGTAAGAAGCACGCGCACGAGAAGCAAACGGCAGGATTCCTCGCTATGTCATGTGGCAACTGCTCAAGTAAATGGATCCAATTCACATG
TCATGTCAGTTTTTTTCGTGCGACTTGTGTTTTTTTCCATCAAAATCAAAAGCAGAAAAACATTTTTATAAAAATACGCTTTTTACGGGTTGGTCATTTT
TTTGGACTCGTCGAGTGGCGTGGGAAGCTACAACAGGCGTGCATCGCATTGGTAGGTCGGCAGTTCGCTTACACACATGACCGGTAGCGGCAGCAGCAGC
AATGGCAAGAGCCAGCACCGGCGCCCGACGCACGGGAAGAAGCCCCACGCTCACAGCAGCAATGGCGGCGTAAAGCGACGCGGCTCCTTCGGTGAATCCA
ACGGCAACAGCAGCACTGCGTTCAAGAAACGCGACAGCAGCAATGGCAACAGCAAAAGCAGCAGCAGCAGCATCGGCAATGGAAGCAGCCTCACCACCAA
GAAGTACGTACCAGAGATCCAGCGCTTGCGCCAGAAGCTGCCGATCTTCGTGCACCGCCAGAAGATTATCTCGACCGTGCAGGAGCACCAGGTCGTGATC
CTCGTCGGCGAGACCGGCAGTGGCAAGACCACGCAGATCCCGCAGTACATCTTTGAAAACAACAACAAGGAACGCATCGCGATCACGCAGCCGCGACGCG
TCGCTGCGATCACGGTTGCGCAGCGCGTGTGCCAGGAAGCGAACAGAGGGCCCATCGGCGAGACGGTCGGGTACTGCGTGCGGTTCGATGACACGACGAC
CAAGTCCACAAAGCTCAAGTTCATGACCGACGGTATGCTCGTGCGAGAAGCGCTGCTGTCTCCGACGCTCGAGCGCTACTCGGTAATCGTGCTGGACGAA
GCCCACGAGCGCACGCTGCAGACCGACATCTTGTTCGGCGTCGTCAAGCAGGCCATGCGCAAGCGCAAGGACCTGAAGGTCGTGGTCATGTCGGCGACGC
TCGACGTCGGGCTCTTCCAGCGATTCTTCGCCGAGAGCAACCCGGCGATCATCCAGATCCCGGGCCGCCAGTTCAACGTCGACGTGTTCTACACCATGAA
GACCCAGCCGGACTATCTGGACTCGGCGCTCGTGACCGTGCTGCAGATCCATATGGACGAGAAGGAGCACAACGGCAGCATCCTGGTGTTCCTGACAGGC
CAGGAGGACATTGAGACCCTCGAGACGCTGCTGGAAGAGTACGCGCGCACGCTCCCCGCGGAAGCGCTGAAGCTCATGGTGTGTCCAATCTTCGCGGCGA
TGCCGCGCGNNNNNNNNNNNNCAAGTGTTTGAGCCAGCGCCCGCGGGCGTGCGCAAGGTGATTCTCGCGACAAACATCGCCGAGACGTCGATCACAATCA
ACGGGATCCGCTTCGTCGTCGACACGGGGCTCGTGAAGCAGCGCTCGTTTGTGGCCAAGAGCGGCATGGAGATGCTGCTGACCGAGCCCGTGTCAAAAGC
CCAGGCGTGGCAGCGCACGGGTCGTGCGGGACGTGAAGCGCCAGGCGTGTGCTATCGGCTCTTTCCCGAAGAGACGTTCGAGCAGCTTGCGGAGCGAGCG
ATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGAGCTTGGAAGTGGTGGTGCTGCAGCTCAAGACCATGGGCATTGACGACATCCTCGGC
TTTGACTTCATCGAGAAACCCAAGACCGCGTCACTCGTCAAGGCGATGGAGAAGCTCTACGCGCTCGGCGCATTCGACCCCACGGGCAAGCTCACGGAGC
GCGGTCGCCAGATGGCGGGCCTCCCTGTCGAGCCGATGTACGCGGTCATGCTGCTCAAGGCCACGGAGCTCGGCTGCGCTGAAGAAGCGCTGAGCGTCGT
GTCCATGCTGTCGGTCGAGTCGATCTTCTACTCGCCGAGAGACAAGAAAGTGCAGGCGGCGCAGTCGCGCGCCAAGTTCCAGGCCTACGAGGGTGACCAG
ATCACGCTGCTTAACATCTTCAACGGCTTCATCCAGGGCAACGTGAAGCAGCGCGCCAAGTGGTGCCACGACCACTTCATCAACTACCGCGCGATGCAGC
GCGTGGAGAGCGTGCGCTCGCAGCTGAAGGGCTACTTGGAGAAGCTCGAGCTGCCGATCGAGTCGAGCTTCCCGGACATTGACCCATTGCGTAAGAGCAT
TGTCGCGGGTTTCTTCTTGAACACTGCGATGCGGTCGCTCGCGGATGGCAGCGGCGGCGCCAAGACCGCGTACAAGACGATGTGCGGACGCTCAGAGATA
GTGAAGGTGCACCCGTCGTCGTCACTGTTCATGCGCAATCCGCCGCCAAAGTGGGTCGTGTTCAACGAGCTGGTGTTCACGAGCAAGCACTACATCCGCT
CGGTGGTGATCATCGAGAAGGATTGGCTGCTGGAGCTCGCGCCAACGTTTTTCAAGAA