Description :
From Genome Similarity Track
Location :
Scaffold_78:87448- 88823
Sequence
1375 bases(100 bases per row)
GGTTGATTGTGTCAAAAGCACGGGAGAGATCGATACCCAGTATGTGGAACCGTTCCTTGAATCTCTGCTCCCGTGCTGCTATCCACGTGTGGGTCCATAC
TGCATCGGCAGTACTGCGACTGGGTCGGAACCCGCTCTGGTGAGGGGACAGAAAGCGTTCGACCTTCGGGGAGATGCGCTCGAGAACGACGAGCGAGATG
GCCTTGCGAATGCTGTTGAGCAGCACAATTGGTCGAAGGCTGGCACATTGACCAGCCGGCTTGTTTGGCTTTGGAAGTCCAAGGAGAATTCCGTCGCCCA
GATGAATGTTTGCTCCAGTAGAGAATCCGTCCTTGAGTATGGCAGCGAGAGGTTGAGCTAGTGTCGTAGATCCGTACTTGAGTAGCTCAGCTGGGATGGC
GTCAGGTCCGGTTGCGCGGCCATTGCGAAGGCGATGGAAGGCGCGTGCGAGCTCGTCGGCTGTAATGGGCCTCTCCAGAGGGCGAGCCACGCTGTCGCTG
GGGACGGACTGTCGGCTCGGGTCGTAAAACTGTTCCTTGAAGTGTTGTCGGATCTTGGCGCCTGCTGTTTTGCGGTGGAGAATGTATTTACCTGTGGAGT
CACATAGAGACGTTAGTGGTGAGCGCTGTCGAAGCAGCACTCGCGTTGCCTCGAACATCCTAGCCGAATGGCTAGAGCGGTCTATGGCGGTTAGTTTCTC
GTCAATAAAAGTGCGAGCAAGGTGTCTGCTGCTCTCCCAGATTTTGTGAAGTACGTGGTTGCGTCGGCGGCGGAGGTCATCGACGTCCAGCGCACGGTCG
TTGTAGATGGCTAGACAGAGTCGTCGTTGTTCGCAGGAGAGACGTGCTAGTTCTGGATCCGGCATTTTGGCGCTTTTGGCGAGTGGAAGGTATCCAATCG
AGTCTGCTGCTGATTCCAGTGCTGTGTTCAGCGTCGTCGCCCAGCGCTGGTTTGGCGATCCCCCCTGGTGTGGCATGGCGGTAGCTGGCGGTATTGTAGT
CGGGAGCGTTGGTCGTGCACTAGGAGGTGCGTGGCGAGGCGAGTCTCGGCGTTGTTGAATTGGACTCTGGCAACTCGACGCTGGAGCCCACCGAGTGCGC
GGAGATCAAAGTCCAGCGTGACCAGCTTGTGGTCGGTCGGTGTGAGGATACCGCCCCACGACTGTGCGTTGATACACAGGGATTTATTCCACTGGCTGCA
AATGATGTAGTCGATTTGGTTGAAGATGCTGTGTTCCTTGAGTCGGAGCGTCCACGTCGTGATGTTGCAAGCGCGCTTTCGGAAAGCAGTGTTAGAAATA
AACAAATCATTGGCGTCACAAAAGGAGGCGAGTACGTGGTCGTTGCGGTTGCGTCGGCCACGTCCCCATTGTCCT