Description :
From Genome Similarity Track
Location :
Scaffold_143:874427- 877042
Transcript NameFunction/comments
Aphin_H310_03316calmodulin

Sequence
2615 bases(100 bases per row)
GTCAAGCCAAGCGACCTGCGGCACATCAACACGTGGCTGCATAGCTTGGACGTCGAGTCGAAGAACTTCACGTCGTACTTTTTGTTTTGTGAAATGAAGT
TCCGCGAGTCGTCCGTCCTCACCACGGGCAAACCCATGCCGAACCGACTGCGCACGGCCGTTGCGTTTCATTGCTTGCAGCACGCGACGAGCCTCTTTGG
CCGGTACCAGCATGTGCTGGGCACAATTTGCCAGTACGCCGCCCCTCGCATCTCGGTGACCTCTTCCTTTCGACGTAATCCATGGGTGTAGGAGCCTAGG
AGCTGCCATCTACTCGGACTACGACGCGCGGCATGTTGCGTCAAGACAACACGCCGAGGCGTCGACCGTGTCGGCGGTTGATTGGTATGAAAAAGGAACG
GCGTACTTTCAAATGGCCGAGCAATTGCGTGGCCAGGTGGATGGACTCCAAGCGCGTAAGTGTGCTATGTCTACTTTGGTTGATTCGACTGGTTCAATCA
CGTCGTGGGCGAAGAGGTCACAGCGGCTGAATTTGAAGCCGAGCGGCTTCGAGAAGAAGTCGCTGCACTGACGAGTCAATGCGACGCACTCAAGCGGCTT
CGCGGACGCAACACGCGGCCGTCCCTCGTCGTCGAGCTCCAAAACATGGGCGCCATGGACAAAGTCGACATGATCTTCAAGACGTTCCAGTCGTTTGACG
CAGCCAACCGACGCAACGTAAGCCATTCATCCTCATCTCCCCCACGACTGCGCCCCGTTGTGCCTTTGACGCGCTGTCCTCAGCACCTGGCTACCGTAGA
TTCTCGTCGGGCTCATTCAAACAGTGGAGCAAAACTTGAGCGCCGAGATGCTGTTTGATGTGGTGCAAGCGATGGCGCATGAAGAAGGCGAGCGTCTCGC
GCAAATGCTGATGCGCGAGTACGACGTTGGCACAACGTACGAGACCTGCTGGAATATTCTGGGAACGTTCTACACCCGCATGCAGGAAAAAGACCACGAA
CGAACACGTCAAGAAACTCCAACGGTTTGTCACCGGATTCGCGTCGACGCTAAAGGAAGTCAACAAGTCGGTGCCGGTGCACGAGGCGGTAGGCGTGCAC
AATATTCATGACGTGGCCTGGGCTGACGGTCGATGCCTCGTCGGCGTAGGCGGCCGCGGAGCAGACGACTGCGGAACTCCAAGCCGAACGCGCCACGTTC
GAAAAGATGTTGCTGCTCAAAACCGAGATGCAAACGCTCAAAGAGAACCACGAAATCGAGCTTCAATTTGAGATGGACAAGACCAAGTTGTTTGAGGAAG
AGTGCAAGGAGCTTATGACCAAGTACCAAGACGCTCTCAAGCGCATCCCCAAGCCACCAGAGGTCTCTGATCACGCCGTTCAAGTCGACATAATGGAGGC
CGAGACAGCCACGAAGCGCAAGAAGAAGCGCGGCGACGTGCGTGGCACATTTCTCGCGTCTGCGTGCGATGCGAGTGACGTATCGTTAGGATGTCGACGA
CGACGACGGGTTTCGAGGAATCTCGGATGTGATTGCCGACGCCAACCTCCCCGCCAAGAAGATCCGAAAGATCTTTTCAAAGAAACACGCCATGGCGCTG
GACGACGTTGCCGGCACGATTGCGAGCTTGTACCAGGCCAAGATGACCCAGGACATCCACGACGACTGCAATGGGAAGCCGCGGTCGGGCTTCCTCAATC
TCGTCGAGGACTTGTTCATCCTGTACTATGGCCTGAAAGAGCTCGCCATCGGCCAGCTCATTTGCATCGACACTGCCGTCCACAAGTTTTGCGAGGTAAG
CGATTCCTTCTCCGCGGAAACCTGACGCGAGTCCTAGCACAATGCTCGCGTGAGACTCTTTGGCATCCTGATCGGGTCGAATGCAGCGGTGTGCGCCACG
CAACCCATGGGACCGTCCCCCGAAGCCATCGACTTCTTCCTCTTCCTCGTTGGCGTCCTCTTCCACGGTACAGTCGAGTCGCTCCAATGCTAGAAGGACT
ACATTCGATGCGGTGTGCAGTTGGCCACTACACGACGCAGTACGAGCATGCCCTGGCCGTTGCGAAGCTGCTCAAGTCTCGGTTCGGCGATGGAATCCCA
CATAGCCCGAACAGCACGCGCATTCATGTCCAGGAAGCGGTCCACGTAGTTCAGATCGCGTTCGCGTTCGACGCCACCACCGACAACCACGAGCACTCGG
AGTGCATCCAACTCGTGCAGGCCCTTGCGCTCAACGACACGATCGACATCGACCAATTCCTGGAGCAAGTCATGCTGCATTGGTTTGCCATGTACGACAG
CCAAGTGGCGTTCATGAAGAAATTGTTTCACAGCATGGACCACGACAAGAATGGTGTGCTGGAGTTCCACGAGTTTAGCGGTAAGGCCATCGCTTCGATT
TCTCCATGATCGGAAAGACGTCGTGCGGTTCGGAACACATTATGATGGCTCTCTGTACAGGCATGGTGCACAAACTTGACCCAGAGATGACTCAGCGCGA
CTCGCTCGCCATGTACAACCGCGTCGCCGGCGTAGACAACGTGATCGATTGCAAAGAGTTCGTCGCGTGCATGATCAGCCACCAGCAGCACTTAATTCTC
AAGACATACTTTGCC