Description :
From Genome Similarity Track
Location :
Scaffold_247:8744- 11690
Sequence
2946 bases(100 bases per row)
TCATACCGTCAACGTCCCAGTAATTGTTTGCTACAAACATGCGCTGACTAGCGACGATTACAACAATTCGGGCTGACTCTCGGCACCACTTCAGGTTTTT
GTGCGGATGTATTGACAATGGTCTTTTCACCTGAAAGAAACAAGAAACAACAAGCACAAACTATGCTCGTGGTCTCAGAGCCGCGTGCAAGACCTACAGG
CTTGCACCTCTTAGCGCCCGAGTGACGTGGAACAGACCTTTTAGTAAGGGAGCGGAGTAGAGCTTCCACGTTATCAGCTCTCGAATGATGCATACAAAAT
CCGCTTACCAGATTGGGACAATGTCGTCGACCAAATCGGTCGGGCTCGTCGTATCCAGTTGTCAGACGATGCCAGCCTGGCCATTCTAGGTTCTGTGGTG
ACGACCATGTTCGGTCGTTCAAATCACGAACACCGGTTGTTTGAACACAAGCCATTCGCAGTGAAAGAAATGCGCCTTTTCGGTGCAACGACGAGGTACC
GAAGCGCAGCTGAACATTTCGGATTGCACATTCCATAGTTTCTATCGCTTGGAAGACGCATCTTGACACGCCCTTCGTAATAATTAAGTGACAGTCGTAT
TCAGAGTGCAATGGACGATAAAATGGACGCGACAAAGTCTTCAAGCGCGGATGTCAGTCATCCGCGAAGCGGGAATGACACCGCGCCGAACTACGATTGC
TACGTCGACTTTGGTACAACACAAACACTGTATATTCTCAACAACTAGTGTTTTTCTACTCTCTGTCGTAGTGTACGAGCTGTTCTACTCAACGGTGCGT
CGCATTCAGCTATTATTGTCAGCGTGGTTGGCGCGGGTATCATCTCAGCGAGCATGACCTTAAATGTTGGGGCATTATGCATATGTGTAAAACGTAAAAT
GTTGAGGCATTATACCTTCGTGTAGAATACGAAATGTCACCAAATAACTTGATATGTGAACAGGCACAATGCCGTTGAACGCGCGGCTTACGCGTTACAG
GATTTGCAACTTTTGAACCGGTCGTACCATGAAGTGACCGACTTCGTCAACCTGATCGGACTTACAACTTACTTATGGTTACGGACGAAGCTTTTGAAGT
GGTCTGCTACTGCATCAAAGTCTCCGCCAACAATCGTTCAGGTGTCTAGTGACAAGTGGTGATAGAACATGATTGCACCAGAGACAGCACGCGAGCTTTA
CGCTTGTCTCCAACGTGAACTTCACCAAGGTTGAGTAAAGCGTTATGTAAGGCTACAACAACAGTGAAAAGGTGTATATTTGTGCCGTTGTGGGATCGGT
CTCCCTATATATCGATAAAAGTCGAGCAAGCCACAGTTGACGTTTTTATTTTGATCCATTCACAGCGGAAAACAAGATCGACGGTACGGATACGGGCGAC
GAGTCCATAGTTGCAGAGGCGGCTTGGCAGCTCGAGATCGTGGTCATTGACTTGCTCTCGAACAGAGCCACTGGATCCATCTTCCACCGTGGCCATATGT
CCAACACGAAAGAAGCACTGCATATAGTCGAACAGAACCCACCCATTTCAATCATGACGGGATCGCAGATGCTCAATCTGAAGCTCGCTTAACAGGCTGC
TATTTTGTTTGTTACCTGCAGCTCTCGTCTTTGCTCGGAGCCTGGATAGGAGTCCAACGGTACGATCATTTGTTAGATGCTAGGGGGTATTCGAAGTTCT
ACTTGTACCGAAGGCTGCCACCAATGAATACAATGAGAATGGTTCGGCACCGTTCTTCTCGACATGAAAATGTTGTAGACGGTGCATTTTGAGAGGGAGT
GATGTATACGGTACTGTACTGCTTCTATCTTGTAACACCACCGCTTTTATAATGGAATACCACGCGTGACAGAATTGGATGGCGAAGTCAATCCGACTCG
GCCTGTCGCAACCGAATGTAGTAGGTGAATTAGTGGTATTTCTAGTGCAATGTCGACCCCAAAATGCCCGTCCTTGAGTTATTGTGATAAATAAATAATT
CAAAAATCGATCAAAACATATTATTGAATTTAGGAAATAAAATAAAACTATTTCATGAAGTGTCGAGCGTGTGCACTCCGAGCATGATGATTATCACGAG
CGACTTAGTTTTCACAAGCCGTGTTACTTTTTGTCAATCGCCCACCTTGACGACACGTCATGGGACGGTCGCAGATCGCGACGTTTGCTAGGGTTTTGAG
CTCACCAGCAAGCCGTTGCTTCTAGCGCTGGTCGCTATGTTTGTAATCGAGCGGACCATTCGCTTCGCCCAACTTGCCGCGAGGACAACTACACCTTCAT
GCCCCGTCTCATACGCCATCTTGATACTCGCTTTGAATCGAATTGGTAGGTTTTTTCGATAACAGCAAAGCTGAAGTAAATGTCGTTGAAATGCGCTGCA
CACCTAATATTTTGCACTGCCTCTGCTCGTGCTATGGATCAAAATCGTGGCCCACACATCGCATTGTTTATCTTTTTTTACGGTATCGTTGCTGCCGAAT
GATTGTCGCCTATTTTAGAATTCTGCCTGCTGCGTGTAGATTGTCTCGCTGGTCAAGCAGAAATCCACGTGATCAGTTAAGAATATATAGATGACATGGC
GTTGCTGAGAAGATCATGCCCAAGACACTATCTATGGATGACTTGAAGTAGACGATCGTCGAAGGACAACAATGCGGAGCTGGGTGGAGTCTTACCGCAG
TGCTAGTTTACACAATCGCAAGAAGGGAAGTAAAAAGAGCCTGTATTGAAGCTGGAAGAAAAGACAAGGGTTTTGATGTAACGGCGAGGAGTGCGTAATG
TAACGGGGCACTGGTCGCTTGTACTGTCACAGTACAAGCTACTTTCACTGAGAACAGAGTAAGTTGGTGCCTCGAAACTTCACATACACGCGTCGTGCAG
AGGAAGGTTTCAACACGAGAAAAGGGGTAAAAGTAGAAAAACTGTA