Description :
From Genome Similarity Track
Location :
Scaffold_20:874326- 882220
Transcript NameFunction/comments
Phyin_T30-4PITG_10728Putative uncharacterized protein
Phyin_T30-4PITG_10729Putative uncharacterized protein

Sequence
7894 bases(100 bases per row)
TACAAGTTTTGTTTGGCCGTGAAAATGAGCTGTTACTTCTTTCTGGGCAACAGCAACCGAATGGCAGAACTTGCGCAGCGACCATCAGCGGCGTGAATCC
CCTTCTATCCTTCAATTTGACGTTGGCTCCACGGCCGACAAGCATTTTCACGACATCATTGGCCCCATTCTTCACAGCAAGATGCAAGGGCGTCCGCTTG
CAATGGTCGTTGGCATCAATGCTAGCTCCTTCATCCACAAGTAGCTTAAACGCGTCTGTATTTCCTCGCGTAGCTGCCATCAGAAGCGGTGTAGCTCCGT
AACAATTCTTTGGGTCGATTGCAGCGCCGTGCATCACGAGGAACCGGCATGTCAAAGCGCATCCGTTGCATGCAGCATAGTGCAATGCAGTATTTCCATT
CGCTGTCTTCGTGTTAGCATTCGCATTCTTCTGTAGCAGAATCAATGCGATGTCGTGCAGTCCAAAATCGGCCGCTACTGTCAACGGTGTCCAACCCCGC
TCATCTGCTTTATCCCGATTGCAACAAGAGTTTACACGTTGCCAAGTGCCCTTCTCTCACTGCAAGATGCAGCACAGAGCTACCGTCCGTCGTACGAACG
TCCACGTTTGCACTTCGAGAGATCAGTTGGCCAACCGCCGCATCTTTTCCTTCTTGTGAAGCGATCATAAGTGGGGTGAACCTCTTGTCGTCAACGGCAT
CGACACACTTAACTCGATCCAAGAGTAAATGCAGAATATCGTCGACACCATTCTCCACTGCTAGATGAAGCAGACTTCTCGAGTCTGTCGTAAAGCGGGC
GTCTGCTCCGTTCTGCAAAAGTAGTTTGGTGACGTCTGTGTGTCCCCTTTGGACAGCTTTCGTCAACGCGTTCAAGCCGGCGTAGTCTACCGAATTCACA
TCGGCGCCACCTCCAATCAGAACACGACAGGCATCAAGACGTCCGTTGTACGCTGCCAAATGCAGCGCCGTGCTCCCGTCCTTCGCTGTGGCATCCACAC
GAGACCCTCGCTTGAAAATCACCCTCAGAATGCTGTCGTTACCCGCACGAGCGGCGGTCATTAACGGTGTAAGCCCCTGCGAGTCCGTTATATAAACGCA
GACATCTTGATCTCTATCCAGCAACAGCTTCACTACTGCGAGCTCCGTCCTCTCTGCTGCGAAGTGTAATGGTGTGCGTCCATACTTATGTGACAGAGAA
AGACAAGCTCCCCTCGATTGGAGCAAGTCGACTACAGCTAGGTGCTCTTCTCGAACAGCTTCCATCATCGGTGTCATCAATTTGTCACCTGCGGCGTCGA
CCTTGGCTCCTGCATCAAGGAGCAATTGAGAAACCTGAAGTCTCCCGTTTCTAGCAGCGTAGTGGAGAGCGGTCGCTCTCTTGTTCGTTCGTGCGTGAGT
GTCTGCACCCCAGTCCAGCAAGAGTTGAGCCGAGCCGATATGGCCACACATAGCTGCATACATTAGCGGTGTCGCGTCGTTCTCGGGTTGAAAATCTTTA
TCAGCTCCGTAGTCAAGCAACACGCTAGCAACCTCGGCTCGGCCACATGCGACCGCGAAAGAAAGAGCCTCGTTCAGATACGTATCAAAGCCCAACGACT
CCGACGAAGAAGCAACTTCAGATTCTTTATGATGCGCTAGAAAGTCAACGACCTCAGCATCTCCACGCCACGCAGCTAGCACGATGGGCGTCATTCCTTT
TTCGTCCTTACACGTGACATCAGCGCGGTTCTTTACAGCGCGTCTCACGTCCCGCAATCGCCCTCTCACCACCGCTTCCAATAGCGCGACGTTGGCAGCA
AGACTCTTTGTCATTTTTGATAAATGAGAGCTGATGCAAACGGATGAAAGTACTCGACTTGCACAAGCTAACTGTCGGACGTTTGATTGCCAGCCGAACA
AAAAAACAGTACAGTCAATCATCGTGAATCACACGCTACATGTAGATGGCGCAGCTTCACTTCTAACTTGGACAAGTCGGCGAAGCGACAATACCACGAC
TTGTGGAAAATAATACAACTTGTGGTACTTTTGCACTCTCTCACTGCTTCCTGCTTTAGACATTTTTATTTACTGCTAGCATGATTCAATGGCGGTATAA
GATACTTTCATGGAAAAGCACAAGGACTTCCACCACCAACCAACTTGGGTAATGGTTGTCAAATCCCGGTGTGGCACACTATGGGCACGCATTCACTTCA
ACATGGCTTCAAATATGCGACATGTGCTCTGTAACACCACCTGATTCGCCAAAAAGAAAACGTCGCCATTAAATAATTACTTCATAATCATGGAGCATCC
TGCACTTAAGTACTACAAACATTTCCACTCATTCGTACCTCCAATCAGATTTCGTTTTGCCAATAAACGTAACCAACCCCAGACACTTCCCTTTCTGTAC
CCCAAGGGAGAAAACGGCGAAGAATCTCCTCAACGCGCCGCTCCTTACGCCTCAACGCGCGTCTCCAGCAGCTCTGCCGTCCTCGTGCACTCTTCATTGG
CCTGTCGGCCGCAATCTTGGCGTCGCTCGCGCTTCGTTCGCGCCTCCAGGAGCTCCAAAAAGCTGCCTATTTAAAACGTTAAAGACACTTAAGAAGTTTT
AAAGCTTGGGACTGAAAATTCCTCGAGTTGAAGGACATGGAAGCCGTACGAAAGCGTCCGCCACGCGCTAAAGCCGCCAAGAAGCCGCCGAAGCAGCAGG
AGGTGGACGCAGCACCGAGTTTCAGCGAGGACGAGGAGGACGCCGCAGTGCAGGCCGCGATCGCTGAGCTGGACGCTGAGACAACGGACCAGGAGATCCG
TCGCAACGAGGAAGACCTGATGACCTTATTACAGGACGGAGGAAGGGAGCAGGAGCTTCTGGTCGCTGAAGGAGCAGACTCGCAACCTCCCAACAATGAT
AATGACAGGGAAGAGAAGGACCTCGAGGATAAAAGTACAGATGCAGGCGCTCCAATCATCTCTCCAATACTTGATAATGGACACGCAGATGCTGCTCCGT
CCGCTCCAGTATTTGAAGAAGAAGAGGATGGGCCGGACCAGTTGCCGCTGCAGCTGACGCCTAGCGCGCCGTCTCCGCCGATGCGGACGACGATGCCGCG
TGCTTTCCACGAGATTTCCGTGTCTGCAACGGAGCCGTCAGCGCCTCCGAGCTGCGACGACGAGGTGGAAGTGGTGGACCCCTCGCGTACGACTCCGTCA
GCGCCGTCGCTGTCGCCTACAGCGTCCAAGAAACTGCGTCGAGTCGTAGCGTCCCCGAGAAATCCTGCGAAATCGAATCCGGTGGCGAGAATGCCGACGA
AATCCGTGACGACAGCGACGGTGGAAGGAGCGACTGCAGCAGTGCGGAGCTCGTTCGCCAAGTCCCACCTGGCCGAGAAGGAGACGGGGAAACACAGCAT
CTACCCGTCGATGCCGAAGCCAGCTGAGTCGACCGAGCGAGGCGCAGAAGCAAGTTACGAGCAGCTGCTGAGGAAGAAGCAAATCCGCGTCAAGCTGGAG
CCTTTTGTCAACTACGAGATGAACTTGATGCGAGCGGAGGCGTCGCAGAAGCGTCAGGAGATGAAGATGCGGCACATTGAGACCAACAAGGGCGAATTGT
ATGCGCGGATAGAGCGCTACTTGTTCTCCGAGTACATTTTACACAACGCGGCGCACACGATGGACGAGTACAAGCAGAAGATCGACGTGCTCGTCAAGAA
AGGTAAGCTATATAGGCTTCGTGTGCTGCCAGCGCGTGTCTTGCAACTGATTTGTTGAGTCTTCTGTCACCAGTGTGGACTTTGGAGAAGAAGCGCGTGT
CGTCAGCGAAGCGCTGTGGCGACAACGTGGAAATCGAGCAGCAGATGGAGTTCCAAACCGCCAGGCTGGAGACTCTGCAGCTGGAAAGACTGAAGACTCA
TCTGGACAAGCTACGGCAACTGCGGACGGTGGAGGCGTCCATCCACACGTTTGACCGGGCGATCTCGTACTTGCACGTGGAGCAGTATCTCAACAGTGTG
TTGCAGGAGCCGACCCTCGTCGGGTTCCTGAACAAAATGAGCTCGTCGTGTGGCGGCAGCAGCGGCATCGACGACTTAGATCTGGTTCCAGAAGGTGCGA
ATTTCTACGAAGGGATTCCTCAGGGCTCGTCGTTTGCGACGTCTGTGGACCACTTGAAATACTGCTTGGACGTGCTGATTTTCTTCGAGAAGAAGGTGAC
ACTGGGGGAAGAAGGAGTCTTTGGACGCGTCCCACAGTCGTTCTATCGTGGCGAGCTGATCTGGCACAGCTCCCATGCTAAGACGCACTACAGCGCTGCT
GGGATGGAGCGCAAGATCAAGTGCTACGCCTGTGGCAGCTTGAATGCGCCTATGAAGTCGAAGCAGTGGTGCAAATTGTGCCAGAGCTGCGATGTGGTGC
TGTACATCCCGCCGTCTTCGGTCTCGACTAAGTCCACAGAGTGGTTCACCAGTGTGCTGCGCTTCCGCCAGTCGCTGCAGAAGTGGATTTCGACCTGTAT
GCAGAGTCTGATGCGCACCAAGTCGCTGCAGAATATGCCGTATCTCCTGATGCACGTGATGTATCTACCTCGGATCTCCACGGACGAGCGCTCGTGGTTT
CTGCGCTTCCTGCAGTTCCCGCGTGCGATGGTGCGAACGGATGGCTCTCTACGCAGTGAATGGAGCGAAGACCTCGTGGATCATTACATTGCGATGCTAC
ATCTGGTGTTCCACCCCGAGAAGCTACGGCGGATGTCGGTCATCGTGTCCAGCGGACCACCCAGCGGCGCTAAAGCGGCAAAGAGTGCGGAGGTCGGTGT
AGCCGACAAGAAAGGCCTGGTCTCACCTGAGTGGGTGCTGCTGGAGAACCCGGAGATGCTGGACCGGTATTTTCTCTCCGACGAAGACTTCGTGGCAGTG
CTGAATCAGTTTCCCAACACCTTTGCATTCGGACAGCTATTTAGCTGCACTTCGGACGTCAAGAAGTGTTTCAGTCGAGCGTTGACTTTGGTGGTGGAGC
TGACGCACAGTTTGCGAGCCTTTCAGGAGTTCGAGAAGCTGCCGACGCGGATCGCGCAGCTCCTGGGTCAGTTGTTGTCTGACGCGGCTGAGCTCCCGGG
ATCGGGTCGCCCGTCTGATTCTTCGAGCTTAAAAGACGCGGTCTTCTATCCGACGCTGTTTGACCAACTGTTTCTTACGAGTCTGCACGGTCTCATGGCA
GCGGATTGCAATCGCGTGGCCTGGAGAAGTTTGAGTTTATTTCCTTTCGGCTCGTTGTCTGAGCTGGCCAAGTGGGACGTGCTGGCTCTGCTGCTCTTCA
ACCTCCACAGTCTTCCGCTGGAGGCGAAAACGGCGTCGGGGTGGATGCAGTTTATTGGCAAACCGACGTCTCAAGGCGTGGACACGAAGGCTTTGGCACG
TCGACATCTATACGACTTGATCGAGGCCGACACGGAGAGTGCCATGCACTTGTTGAACGCGGTAGCTAGTCTGGCTGCGTCATGCCAGTCTGGGACTGCG
GGCGAGCGGCATGACCTCGTGTCTGTGGCGGTGCACGAGTTGTTCATGGCAGGATACACAGTAAAGCCATGTCAACAGGCTCTAGGCGAGAACGGCGAGC
GCGCGGCAGGCCCTCTAAGCACCATCTGCTTGGCCCACCCGTGGGTCCTCTCGCTGCTGATCACGCTGCTTTTCAAGTTTCACGAGTGCGCTGCCACGTG
GATTCACATCTTTGAGACGTTCCCGATCAATCGCTGGATGCCCACGCCCCAGGACTTGTTGAACTTACAGGAATGGCTGCTGCTTGAGGACACTACCGCT
CCTCGTAGTGCGCTTGCTCGCTTCCTGTTGGACCACATCAATTGGGAGTATGACGTCAAGTTGCAGCGCTTGTTCACAGATGCAATGCTGCATCGGCAGG
TAGCGCTCATGGTCGCGGAAGCTCTGGTGCTGTACAAGACGAGGAAAGAGCGGGCAAGTGATCCCGAGTCCGCGATCGTGCTGTCTGGCGGTGGCTCTCC
ACAGAAACTCGAAGTGACGTCAATTGCCAAGTCGATTCGTCGTGCGTTGTGGCTGGAGGAGACGGTGGATTTCGAAAAGTGGTGCTGGAAACTGATGCTC
AAGTTGAGGTTTTACTCCCCGAAGACCCACGAGCCGTTGCTGCCACTGATCGACCTTCGTCATGATCGCTCCAGGGAAGCGTTGACTTTGCGTCGATGGT
TTGCTGGGGCCTCCGTGTTGCGGGTGCTTTCTTCTCGGAAAGTCTTCCCGTTCTATACGTCGCTGGAGGAGCACGTGGCGCACTACGGAGTCGGCGACAG
TGAGCGACGTAGGACAGCAGATCCAGCGATGGATGGCAGCACTGGCGCTCCTATTCAGCAGGAAGCACGCCTCCTTTTGACGCCTCAGAACCCCAGAGGA
ATGGACATTGAGTCCACCGTTTCAGCCACGGCAGCGCCACGCACAGAGCCCATTGTGGCCTATGTGGTCTGCCAGATGACGACGTTTGTGTTCAGTGACC
GTCTCGATCGCTGGGAGCCTCTTCTGGTATTGCTCAAGAGCGAGTTCTTCCCCGCTGCGGTCAAGGTGCTGGAGAACTTCTTCCCGATCTTGTCTCGACT
CGACAAACTGAAAGACTGCCCAGCAGAAAGCGAGAGTGAGTCCAAGACGGCGACGTCGAACAGCGAGGACGATGCGGAGGCGACGTCATCCTCGGACGAG
GTGGAAGCTGAAGAAGACGGCGATTTGGTTGCGGACTTGGACAACGAGCTGGAGGCGTGTATGGCAGCGATGCAAGCTCTCTCTACCGACGAGCTGCTGA
GTCTGCTGGGCTCTTTGCACGAGTTCTCGTACATCAACACAGACGAGCTTCATCGCATGCAGGAAGTGCTGAACAAAGGCTACATCGGCGGGTGGGAGAG
CACGGCGAAGGAGCGGATCCTGGCGAAGCTTCGCTTTGTGCGTGAGTGCAGTCGCTACTTGCACCCTGTGGTGCTGCCTGCTCTCATCAACGAGTGCTTT
CCTCAGTCGAGTCCCGTATCGGTCACGACGTCTGCGTTGTTTCACGGTGCCATGTCGTGGATCTCGTCGGCGTTGGGTGGAGAAAACAGCACAGGAGCGT
TGTCACCGTCAGCTGCGTCATCGACGAGTGCAGCGTTATCGATCCGGAACTCTTCGCTGACTGCCACGACAGCGTCTCTAGCGATGATTTCCGGCACTGA
GTACTCCACGTCGACGAAAGCGTTGTGTGCGCTGATCCGACGCTCCTTCGAGTACTCTGTGGACGACTCGACGCTCACGCAGGCGATGACGTTCTGGGTG
AAGGCGCTGCTGCAAGTTCCGTTCTGGTACGAGAATGCTGCCTTCCGACATGTCTTGGACGTCATGTTGCACTGCAGCATGGAGAACTCGTATGAATCTT
CTCTGGTGAAGAATAAGACGAGGAGTAGAGATACGTCCGACGTGTTGTACGAGCTGGTGGCTCTGATTGAAGCTGCGTTCGACTCTTACTGTCAGCGGAT
TGCACGGAGAGAAGAAGACGCAGGACAGCCAGAGCAGCAGTTCCTCGAGAATGAGCCTGTGATTGTCATGAGTTTCCTCCCAGCGGCAGCGGCGTCAGCG
ACGTTTGCGTCGATTTTTGGAGGTTCGTTCGACGTGGCGCAGTACGTCAGTGGGTGTCCGTCTCTGGCGCTGTGGAGCTTGCTGATTGAAACGCGCAAAG
AAGTGCCGCTGTTCCTCGCGATGGGCCAACTGATGATCAGGTACGAGCCTAAGACGATGAAGAAGCTGGAGAAGATGAAGACGACGGAAGGTAGACTTGG
TGCTGCACTCAGTGCAGTGCGAGAAGGGAAGAGTGTGGACGACCAAGCGGAGGAGACGATCTATGACGCGTCTTCAAGCTCTTCGCGTTTCGGG